点击显示 收起
Received 13 December 2002/ Returned for modification 26 May 2003/ Accepted 8 June 2003
ABSTRACT |
---|
Top Abstract Introduction Materials and Methods Results Discussion References |
---|
INTRODUCTION |
---|
Top Abstract Introduction Materials and Methods Results Discussion References |
---|
MATERIALS AND METHODS |
---|
Top Abstract Introduction Materials and Methods Results Discussion References |
---|
PCR amplification. DNA was extracted from whole blood and spleens with either the Isoquick blood kit (Orca Research) or the Qiagen tissue kit by following the recommendations of the manufacturers. PCR was performed with an MJ Research thermocycler using Taq polymerase and buffer reagents from Qiagen Corp. as recommended by the manufacturer. General primers ERIK1 (TGCGGRGGAAAGATTTATCGCT) and ERIK2 (GAATTTTACCTCTACACTCGG), designed to amplify a 500-bp region of the 16S rDNA gene for Ehrlichia spp. in addition to that of Rickettsia spp., were used for initial screening. Amplification conditions used were 40 cycles of 94°C for 45 s, 60°C for 45 s, and then 72°C for 45 s. Ten microliters of product was analyzed on a 1.5% agarose gel next to a 100-bp DNA ladder (Gibco BRL). A sample of positive PCR products was purified with Qiagen spin columns and sent to the University of Maine sequencing facility for sequence analysis.
New 16S rDNA primers were designed to specifically amplify A. bovis. A nested reaction was devised to maximize sensitivity. Primers BacA and 1448r were used in the outer reaction as described previously (4). Inner primers Bovis74f (TGTTCTCGTAGCTTGCTATGRG) and Bovis867r (GGAGGTAAAAACCCCCACATC) were designed to amplify a 700-bp piece of the 16S rDNA gene under the same reaction conditions as those described by Chen et al. (4). These primers were tested for specificity on known positive samples containing A. phagocytophilum, the white-tailed deer agent, E. chaffeensis, and Neorickettsia risticii, and produced amplicons only from rabbit samples for which PCR sequencing of the ERIK1 and -2 amplicons indicated the presence of A. bovis. All subsequent PCRs were carried out with these primers. A. bovis had never been received or maintained in the Harvard laboratory. Safe PCR was always practiced: separate rooms were used for reaction setup and analysis, and dedicated pipettors were used for each step in the process; dUTPs and appropriate negative controls were included for all PCRs.
Statistics. Confidence intervals (CI) around prevalence estimates were calculated by the exact binomial method using the STATA software package.
Phylogenetic analysis. To identify the rabbit agent, we performed phylogenetic analysis. A large piece of the 16S gene, 1,200 bp, was amplified for use in the phylogenetic analysis with the forward primer ERIK1 and the newly designed reverse primer Ehr1500 (CTTAAATGGCTGCCTCCTTKCG). The PCR was performed as described above. The sequence from the rabbit agent was aligned with those of known Ehrlichia spp. retrieved from GenBank with ClustalX and then adjusted by eye with GeneDoc (K. B. Nicholas and H. B. Nicholas, Jr., GeneDoc: a tool for editing and annotating multiple sequence alignments [distributed by the authors], 1997). Maximum-parsimony analysis using PAUP (17) and neighbor-joining analysis using MEGA (12) were performed. The robustness of the tree topology was assessed by using 500 bootstrap replicates. Rickettsia rickettsii was used as the outgroup, following prior analyses (11, 20).
The following are the GenBank accession numbers for the sequences from the organisms included in the phylogenetic analysis: E. chaffeensis, U60476 and U23503; Ehrlichia ewingii, U96436; Ehrlichia canis, AF162860; Cowdria ruminantium, AF069758; Ehrlichia bovis, U03775, white-tailed deer agent, U27104; E. equi, AF172165; Ehrlichia phagocytophila, M73220; Anaplasma marginale, M60313; Ehrlichia sennetsu, M73225; Rickettsia rickettsii, U11021.
Ticks. Ticks from rabbits were collected and sorted by species and stage. Partially engorged ticks were crushed individually in 50 µl of phosphate-buffered saline on a 96-well plate and then pooled in groups of six. DNA was extracted by a standard phenol-chloroform procedure and tested by PCR. We were careful to distinguish evidence of infection due to the blood meal from that demonstrating transstadial survival, and therefore ticks collected from PCR-positive animals were removed from subsequent analyses. Replete ticks were held at 24°C and 90% relative humidity and allowed to molt. They were then pooled in groups of five and tested for evidence of infection by PCR.
RESULTS |
---|
Top Abstract Introduction Materials and Methods Results Discussion References |
---|
|
|
|
Analysis of ticks. The majority of ticks collected from these rabbits was identified as H. leporispalustris or Ixodes dentatus. I. dammini was also found. To identify the vector of A. bovis, we tested ticks collected from rabbits by PCR. All species of ticks were determined to be infected (Table 2). None of the I. dammini females and only 1% (minimum infection rate ; 95% CI, 0 to 7%) of nymphal ticks tested positive. Although no nymphal or female I. dentatus ticks were found to be infected, 2% (MIR; 95% CI, 0.2 to 5%) of I. dentatus males were positive. In contrast, all stages of H. leporispalustris were infected. Although H. leporispalustris appears to be the main vector of A. bovis between rabbits, we cannot exclude a secondary role for Ixodes spp.
|
DISCUSSION |
---|
Top Abstract Introduction Materials and Methods Results Discussion References |
---|
Although infected rabbits were identified every year, the prevalence of A. bovis infecting rabbits seemed highly variable (Fig. 2); this, however, may not reflect actual infection status. Both A. bovis and E. ovina infections are characterized by premunition. It has been demonstrated that splenectomy causes recrudescence 1 year after apparent recovery from the initial infection (14, 16). We did not splenectomize rabbits to determine infection rates and believe that, even using a nested PCR, we probably cannot distinguish between uninfected rabbits and those with small numbers of infected host cells. Monocytes generally comprise less than 1% of all leukocytes in circulating blood, and therefore few infected cells would be present on a blood smear and A. bovis sequences in our extracted DNA would be rare. Preliminary evidence, however, suggests chronic persistence of this infection in rabbits: we identified three rabbits that remained PCR positive when recaptured in a subsequent month. Chronic infection would impart great reservoir capacity, supporting stable transmission.
We have failed, to date, with all attempts to propagate the organism either by inoculation of various laboratory animals or by cell culture methods that have been successful for other Ehrlichia spp. To our knowledge, A. bovis has never been continuously cultivated in vitro, although it has been maintained for a few days in primary leukocyte cultures (15). The starting material for these temporary cultures was 20 ml of buffalo blood. It is possible that we simply did not obtain enough parasitized cells from the limited volume of blood obtained from rabbits to successfully initiate cultures.
Most tick-borne agents have evolved a specific host-parasite interaction with their vector, and it seems axiomatic that a given agent is locally maintained by only one tick species. For example, Lyme disease spirochetes and A. phagocytophilum are maintained only by I. dammini even in sites where Dermacentor variabilis or Amblyomma americanum are sympatric (our unpublished data). The metastriate tick genera Hyalomma, Rhipicephalus, and Amblyomma (16) have previously been reported to transmit A. bovis to cattle. The metastriate H. leporispalustris appears to be the main vector on Nantucket because all stages were found to be infected and were competent for transstadial transmission. However, we were able to identify A. bovis in all three species of ticks tested and can exclude the possibility that this finding reflects contamination by the host blood meal because ticks that were attached to PCR-positive rabbits were not included in our analysis. A. bovis was transstadially maintained in the prostriate I. dentatus, albeit at a lesser efficiency than in H. leporispalustris, suggesting the possibility that it serves as a secondary vector. Thus, perpetuation would be facilitated by the capacity of A. bovis to use either prostriate or metastriate ticks as vectors.
How this infection came to be on Nantucket is a matter of conjecture. However, Nantucket Island was a major port for whaling and shipping during the 1800s and early 1900s. Material goods as well as livestock were imported through Nantucket harbor, and it is possible that either foreign livestock or their ticks introduced the pathogen to the Nantucket fauna. Cottontail rabbits themselves are, in fact, not native to Nantucket and were intensively introduced from the central and southern states (9) during the 1920s and 1930s by sporting clubs. The introduced S. floridanus eventually competitively displaced the New England cottontail, Sylvilagus transitionalis. Interestingly, the agent of tularemia was thereby introduced to New England (2, 3), and it may be that A. bovis and Babesia divergens (10) were introduced similarly. Then too, subadult I. dentatus and H. leporispalustris parasitize birds, which may transport ticks great distances, perhaps even from the tropical Americas, where A. bovis has been reported to infect cattle. We are able to rule out transient introduction by migratory birds, however, by detecting infection in rabbits each year for 5 years and infer that a local cycle is well established.
The human and veterinary public health significance of our findings is uncertain. Reports of disease in cattle are conflicting. A. bovis infection in cattle has been documented as asymptomatic (7) but has also been associated with death within hours to days of the first signs of symptoms (16). We did not determine whether local cattle may be exposed, as there are only a few (a dozen) head of cattle on Nantucket, all of which are carefully maintained. However, the host specificity of H. leporispalustris makes it an unlikely source of infection for cattle. The rabbits collected in this study did not show any obvious signs of infection. There are no known reports of A. bovis infection in humans, although macaques have been experimentally infected and sustain a flu-like illness (6), suggesting that human infection may result in illness. The public health burden would depend on the propensity of the involved ticks to bite humans. I. dentatus and H. leporispalustris feed as adults only on lagomorphs, although subadults may also infest birds. We note that I. dentatus may more frequently attach to humans than previously reported (1). In addition, I. dammini ticks, which feeds on rabbits as larvae, would have the opportunity to transmit A. bovis to humans as nymphs or adults. Accordingly, serologic studies of febrile cases from Nantucket (or other sites where humans commonly see rabbits) should be undertaken if A. bovis is propagated in vitro and a specific antigen becomes available.
REFERENCES |
---|
Top Abstract Introduction Materials and Methods Results Discussion References |
---|