FcRIII engagement provides activating signals to NKT cells in antibody-induced joint inflammation

1Department of Pathology and 2Laboratory of Immune Regulation, Graduate Program of Immunology, Seoul National University College of Medicine, Seoul, Republic of Korea. 3Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul, Republic of Korea.

    Abstract

NKT cells promote antibody-induced arthritis, but the mechanism by which NKT cells are activated in this model remains unclear. It has been proposed that Fc receptor (FcR) contributes to NKT cell activation in antibody-induced arthritis. To address this issue, we explored the functions of FcR on NKT cells in antibody-induced arthritis. RT-PCR and flow cytometric analysis demonstrated that NKT cells constitutively express surface FcRIII but not FcRI, -II, or -IV. FcRIII engagement by aggregated IgG on NKT cells enhanced CD25 and CD69 expression, whereas FcR–/– mouse NKT cells did not enhance activation. FcRIII engagement on NKT cells enhanced the production of IL-4, IL-10, IL-13, and IFN-, whereas FcR-deficient NKT cells did not alter the production of these cytokines after aggregated IgG treatment. However, FcR-deficient NKT cells were functionally intact in terms of TCR-induced activation. Moreover, adoptive transfer of FcR-deficient NKT cells could not restore inflammation or TGF-? production in the joint tissues of CD1d–/– mice, whereas adoptive transfer of wild-type NKT cells induced arthritis and reduced TGF-? production in joint tissues. We conclude that FcRIII engagement by IgG in joint tissues provides activating signals to NKT cells in antibody-induced arthritis.

    Introduction

NKT cells express intermediate levels of a semi-invariant V14J218 TCR in mice and an invariant V24J15 TCR in humans (1), which recognizes glycolipid antigens presented by CD1d molecules (2). The –galactosyl ceramide (-GalCer) binds to CD1d and these complexes are recognized by the TCR of NKT cells (3). Upon activation, NKT cells rapidly produce large amounts of IL-4 and IFN- (4), which play critical roles in the regulation of immune responses by NKT cells (5). In animal models, NKT cells have been reported to affect the development and progression of diabetes mellitus (6), experimental autoimmune encephalitis (7), rheumatoid arthritis (8), pulmonary fibrosis (9), and lupus (10).

NKT cells play an indispensable role in the induction of antibody-induced joint inflammation by suppressing TGF-?1 production in joint tissues, which in turn is dependent on IL-4 and IFN- secreted by NKT cells (8). In addition, -GalCer slightly enhanced arthritis in C57BL/6 (B6) mice of the KRN TCR transgenic mice of C57BL/6 (B6) background x NOD mice (K/BxN; see Methods) serum transfer mouse model, which suggested that TCR engagement on NKT cells may contribute to NKT cell activation in this model. Therefore, we speculated that cellular glycolipids provided by apoptotic cells during the development of arthritis are presented to TCR on NKT cells by CD1d-expressing cells in vivo and thus activate NKT cells to secrete IL-4 and IFN-. This speculation is supported by several reports that demonstrate that CD1d molecules are able to present cellular glycolipid to activate NKT cells (11). However, it is unclear whether TCR engagement on NKT cells provides the critical activating signals to NKT cells in the K/BxN serum transfer model. Alternatively, it is feasible that Fc receptor (FcR) engagement provides potent activating signals to NKT cells independently of simultaneous TCR stimulation in vivo. Moreover, FcRIII–/– mice show a slowly progressing arthritis, which suggests that FcRIII is responsible for the development of antibody-induced arthritis (12, 13). Unlike conventional T cells, NKT cells are characterized by the expression of FcRIII, a potent activating receptor on NK cells that contains an immunoreceptor tyrosine-based activation motif (ITAM) in its cytoplasmic domain (14, 15). Thus, we hypothesized that IgGs deposited against antigens in joint tissues are recognized by NKT cells through FcR independently of TCR signals and that the signals generated by FcR activate NKT cells to produce cytokines and contribute to joint inflammation. To address this hypothesis, we investigated whether FcR on NKT cells contribute to NKT cell activation in a K/BxN serum transfer model.

Here we show that FcRIII engagement on NKT cells enhances CD25 and CD69 expression and cytokine production in vitro. Moreover, the adoptive transfer of FcR-deficient NKT cells does not restore joint inflammation of CD1d–/– mice, whereas wild-type NKT cells induce arthritis in the antibody-induced joint inflammation model. Taken together, these findings indicate that FcRIII engagement by IgG in joint tissues provides activating signals to NKT cells in antibody-induced arthritis.

    Results

NKT cells constitutively express surface FcRIII. To investigate the functional roles of FcR in NKT cell activation in the K/BxN serum transfer model, we explored in detail the expression pattern of FcR on sorted hepatic NKT cells from B6 mice containing all subpopulations of NKT cells. These hepatic NKT and NK cells expressed FcRIII mRNA but not FcRI, -II, or -IV mRNA (Figure 1A) as detected by RT-PCR, whereas FcRI, -II, -III, and -IV mRNA was detected in splenocytes. FcRIII surface expression was confirmed on hepatic NKT and NK cells by flow cytometric analysis using 2.4G2 (Figure 1B), a mAb that specifically reacts with FcRII and -III (16). To confirm the specific expression of FcRIII on NKT cells, liver mononuclear cells (MNCs) were preincubated using a Ly17.2 mAb that specifically binds FcRII molecules and stained using 2.4G2. The fluorescence intensities of 2.4G2 on NK and NKT cells were not reduced by preincubation with Ly17.2 mAb, whereas those on B cells were attenuated (Figure 1B). Moreover, the expression of FcRII molecules was not found on T, NK, or NKT cells, whereas B cells expressed FcRII on the cell surface. These findings indicate that hepatic NK and NKT cells express FcRIII but not FcRII on the cell surface. FcRIII expression was lower on hepatic NKT cells than on NK cells. In addition, the expression pattern of FcR on NKT cells derived from the thymus and spleen was similar to that on NKT cells from the liver as determined by flow cytometric analysis (data not shown). The NKT hybridoma double-negative 32–D3 (DN32-D3) cells expressed FcRII and -III mRNA but not FcRI mRNA, as confirmed by flow cytometric analysis (data not shown). The FcRIII+ NKT cells were either CD4+CD8– (42.2%) or CD4–CD8– (48.2%), whereas CD4–CD8+ FcRIII+ NKT cells were barely found in the liver. It has been reported that CD4–CD8– DN NK1.1+ T cells express FcRIII but not FcRII, which is consistent with the FcR expression pattern on hepatic NKT cells (15). In addition, 62.3% of FcRIII+ NKT cells were reactive for -GalCer/CD1d dimer (Figure 1C). These findings indicate that FcRIII+ NKT cells are a mixed population of cells that consist of invariant NKT (iNKT) and non-iNKT cells. Taken together, these findings show that NKT cells constitutively express FcRIII, but not FcRI, -II, or -IV, on the cell surface in amounts lower than those on NK cells.

   Figure 1

NKT cells constitutively express surface FcRIII. (A) FcRI, -II, -III, and -IV expression on sorted NK1.1+TCR?+ NKT cells, NK1.1+TCR?– NK cells, and splenocytes (SPC) freshly isolated from B6 mice was analyzed by RT-PCR. (B) FcRII and FcRIII expression was analyzed on gated NKT cells, NK cells, NK1.1–TCR?+ T cells, and B220+ B cells using 2.4G2 or Ly17.2 mAb. Cells were also preincubated with Ly17.2 mAb and stained with 2.4G2. As a negative control, cells were stained with isotype-matched IgG for 2.4G2 or Ly17.2 mAbs (open histogram). Numbers indicate mean fluorescence intensity (MFI) ± SD. (C) The expression of CD4/CD8 or V14+TCR was analyzed on gated TCR?+2.4G2+ liver MNCs using anti-CD4 and CD8 mAb or -GalCer/CD1d dimer. Numbers indicate percent of cells ± SD. (D) Liver MNCs were freshly isolated from B6 mice and cultured with -GalCer (220 ng/ml) or aggregated IgG (Agg IgG; 10 μg/ml) for 24 hours. FcRIII expression was analyzed on gated NKT, NK, and T cells. Open histograms represent negative controls, which were stained with anti-NK1.1 and -TCR? mAbs and isotype-matched IgG for 2.4G2. Numbers indicate MFI ± SD. Results are representative of 3 independent experiments. *P < 0.05.

Next, to determine whether activating signals through TCR or FcRIII on NKT cells upregulate FcRIII expression, liver MNCs isolated from B6 mice were treated with -GalCer or aggregated IgG in vitro. FcRIII surface expression on NKT cells was significantly upregulated upon TCR engagement by -GalCer/CD1d (P < 0.05), whereas FcRIII surface expression on NK cells or conventional T cells was not enhanced after -GalCer treatment (P > 0.05; Figure 1D). In addition, aggregated IgG did not upregulate the expression level of FcRIII (Figure 1D) and TCR (data not shown) on NKT cells. These findings indicate that the constitutive expression of FcRIII on NKT cell surfaces is upregulated by TCR stimulation.

FcRIII engagement induces NKT cell activation independently of TCR stimulation. To examine whether FcRIII engagement activates NKT cells, the expression levels of activating markers such as CD25 and CD69 on NKT, T, and NK cells from B6 and FcR–/– mice were measured after FcRIII engagement by aggregated IgG. FcR–/– mice are deficient in FcRI, FcRIII, FcRIV, and FcRI expression because the deleted  chain subunit is essential for the cell surface expression of these molecules (17, 18). Therefore, NKT cells from FcR–/– mice lack FcRIII expression on the cell surface. FcRIII engagement enhanced CD69 and CD25 expression on B6 mouse NKT cells, whereas FcR–/– mouse NKT cells showed no CD69 or CD25 upregulation (Figure 2A). However, noncomplexed IgG did not alter cytokine production or activation marker expression of NKT cells, suggesting that crosslinking of FcRIII engagement is critical to activate NKT cells through FcRIII (data not shown). Moreover, aggregated IgG did not upregulate CD69 and CD25 expression on T and NK cells from B6 and FcR–/– mice (Figure 2A).

   Figure 2

FcRIII engagement activates NKT cells. (A) Liver MNCs from B6 or FcR–/– mice were cultured with or without (–) aggregated IgG (10 μg/ml), and CD25 and CD69 expression was analyzed 24 hours after stimulation. Open histograms represent negative controls, in which cells were stained with anti-NK1.1 and -TCR? mAbs and isotype-matched IgG for anti-CD25 or -CD69 mAb. Numbers indicate MFI ± SD, from 3 independent experiments. (B) DN32-D3 cells were stimulated with or without aggregated IgG for 2 hours, lysed, and immunoprecipitated with anti-Syk or -Lyn mAb followed by anti-phosphotyrosine (anti–p-Tyr). The same cell lysates were directly blotted using anti-Syk or -Lyn mAb. Sorted NKT and DN32-D3 cells were stimulated with and without aggregated IgG for 24 hours, and the total proteins were separated by SDS-PAGE and immunoblotted using anti–T-bet or –GATA-3 mAbs. (C) Sorted NKT cells from B6 or FcR–/– mice (1 x 105 cells/well) were stimulated with aggregated IgG for 48 hours. The amounts of IL-4, IFN-, IL-10, and IL-13 in the culture supernatant were measured using ELISA. (D) Sorted NKT cells from B6 mice (1 x 105 cells/well) were cultured with aggregated IgG or anti-CD3 mAb at the indicated concentrations, and the amounts of IL-4, IFN-, IL-10, and IL-13 measured using ELISA. (E) The same cells as in D were cultured with aggregated IgG (10 μg/ml), anti-CD3 mAb (100 ng/ml), or both for 48 hours. The amounts of IL-4 and IFN- were measured using ELISA. Results are representative of 3 independent experiments. *P < 0.05; **P < 0.01; ***P < 0.001.

To investigate whether FcRIII engagement induces signal transduction enhancement in NKT cells, we measured the phosphorylation status of Syk and Lyn kinases, which are components of the signal transduction through FcRIII, in DN32-D3 cells after aggregated IgG treatment. FcRIII engagement results in the tyrosine phosphorylation of ITAM by members of the SRC kinase family, which subsequently recruits cytosolic protein kinases containing the SH2 domain, most notably Syk and Lyn (19, 20). We found that FcRIII engagement on DN32-D3 cells increased the phosphorylation of Syk and Lyn in total cell lysates (Figure 2B). These findings suggest that FcRIII engagement provides activating signals to NKT cells through Syk and Lyn phosphorylation.

To functionally evaluate the effects of NKT cells activated through FcRIII, we measured the amounts of the cytokines produced by NKT cells stimulated with aggregated IgG. FcRIII engagement significantly enhanced the production of IL-4, IFN-, IL-10, and IL-13 by NKT cells from B6 mice, whereas NKT cells from FcR–/– mice showed less production of these cytokines after aggregated IgG treatment (Figure 2C). These findings indicate that production of all cytokines in response to aggregated IgG by B6 NKT cells is significantly greater than that of FcR–/– NKT cells. Consistent with these findings, FcRIII engagement increased the expression of the transcription factors T-bet and GATA-3 in the sorted NKT cells and DN32-D3 cells (Figure 2B), factors critical for the production of Th1/Th2 cytokines in immune cells (21, 22). Taken together, these findings demonstrate for the first time to our knowledge that FcRIII engagement provides potent activating signals to NKT cells independently of simultaneous TCR stimulation and that this engagement results in enhanced cytokine production.

To investigate in more detail the effects of TCR and FcRIII stimulation on NKT cells, we compared the relative strengths of the activating signals from TCR and FcRIII on NKT cells by measuring cytokine production after stimulating liver MNCs of B6 mice with anti-CD3 mAb or aggregated IgG. Maximal production of IL-4, IFN-, IL-10, and IL-13 in NKT cells stimulated with anti-CD3 mAb were higher than those in NKT cells stimulated with aggregated IgG (Figure 2D). These findings suggest that the relative strengths of activating signals in NKT cells through TCR engagement appeared stronger than those through FcRIII engagement in terms of cytokine production. Alternatively, the difference in surface receptor expression of TCR and FcRIII on NKT cells is also possible to explain the weaker cytokine response following FcRIII ligation. Nevertheless, FcRIII engagement provided signaling sufficient to activate NKT cells without the involvement of TCR signals and thus may contribute to the modulation of immune responses in vivo. Next, to explore whether the simultaneous engagement of TCR and FcRIII exerts effects on NKT cell activation, sorted NKT cells were cultured with suboptimal concentrations of anti-CD3 mAb and/or aggregated IgG, and cytokine production was measured in culture supernatant. When cultured alone, both TCR and FcRIII engagement activated NKT cells to produce IL-4 and IFN-. The activation signals through both TCR and FcRIII on NKT cells enhance cytokine output significantly compared with activation signals through TCR or FcRIII alone on NKT cells. However, the amount of these cytokines produced by NKT cells activated by simultaneous engagement of TCR and FcRIII was similar to the total amounts of cytokines produced by NKT cells activated using anti-CD3 mAb or aggregated IgG alone (Figure 2E).

The engagement of FcRIII on NKT cells promotes antibody-induced arthritis. To determine whether the effects of FcRIII engagement on NKT cells play a critical role in antibody-induced arthritis, we examined joint inflammation in CD1d–/– mice administered NKT cells from B6 or FcR–/– mice after K/BxN serum transfer. As previously reported, B6 mice showed measurable joint swelling at 4–5 days and maximal swelling at 8–9 days after serum transfer, whereas CD1d–/– mice were resistant to the development of arthritis (8). However, CD1d–/– mice administered NKT cells from B6 mice showed measurable swelling, like that of B6 mice, and CD1d–/– mice administered NKT cells from FcR–/– mice showed minimal joint swelling, like that of CD1d–/– mice (Figure 3, A and B). Histological examination of the ankle joints of CD1d–/– mice administered NKT cells from B6 mice at day 5 after serum transfer revealed marked neutrophil infiltration of the synovium. In contrast, CD1d–/– mice administered NKT cells from FcR–/– mice showed mild inflammatory cell infiltration in the ankle joints (Figure 3B). To confirm the infiltration of NKT cells in joint tissues, we measured the V14J218 TCR mRNA level in the joint tissues of CD1d–/– mice administered NKT cells from B6 or FcR–/– mice after K/BxN serum transfer. RT-PCR showed the presence of V14J218 TCR mRNA in the joint tissues of CD1d–/– mice administered NKT cells from B6 and FcR–/– mice at 10 days after serum injection. The presence of V14J218 TCR mRNA was not demonstrated in CD1d–/– mice (Figure 3C). Moreover, real-time PCR demonstrated that the concentration of V14J218 TCR mRNA in the joint tissues of CD1d–/– mice administered B6 mouse NKT cells was similar to that of the joint tissues of CD1d–/– mice administered FcR–/– mouse NKT cells (Figure 3C). Taken together, these results suggest that primarily FcRIII engagement, rather than TCR engagement, contributes to NKT cell activation in this K/BxN serum transfer model.

   Figure 3

Adoptive transfer of Fc R–/– mouse NKT cells into CD1d–/– mice does not restore joint inflammation in a K/BxN serum transfer model. (A) Sorted NKT cells (3 x 105 cells/mouse) from B6 or FcR–/– mice were adoptively transferred into CD1d–/– mice (B6 NKT transfer or FcR–/– NKT transfer, respectively) 1 day before the K/BxN serum transfer (n = 5 per group). Clinical scores and ankle thickness were monitored in B6 and CD1d–/– mice as well as in CD1d–/– mice administered NKT cells of B6 or FcR–/– mice after injecting K/BxN serum. (B) Histological and gross examination of the ankle joints of B6 and CD1d–/– mice as well as CD1d–/– mice administered B6 or FcR–/– mouse NKT cells 5 days after serum transfer. Original magnification, x200 (middle panels); x1,000 (bottom panels). Arrows in bottom panels indicate neutrophils in the joint tissues. (C) RT-PCR and real-time PCR were used to determine V14J218 TCR mRNA levels in the ankle joint tissues of B6 and CD1d–/– mice as well as CD1d–/– mice administered B6 or FcR–/– mouse NKT cells. RT-PCR and real-time PCR were performed 10 days after K/BxN serum transfer. (D) TGF-?1, IL-4, and IFN- mRNA levels were measured by real-time PCR in the joint tissues and spleens of B6 mice, CD1d–/– mice, and CD1d–/– mice administered B6 or FcR–/– mouse NKT cells 10 days after K/BxN serum transfer. Results are representative of 3 independent experiments. *P < 0.05; **P < 0.01.

To rule out the possibility that the failure in restoration of joint inflammation in CD1d–/– mice administered FcR–/– mouse NKT cells might be due to a functional defect of FcR-deficient NKT cells, we examined the functional activity of NKT cells from FcR–/– mice by measuring hepatic NKT cell numbers in FcR–/– and WT mice and cytokine production by NKT cells stimulated with -GalCer in both animal types. The numbers of NKT, NK, CD4+, and CD8+ cells in FcR–/– mouse livers were similar to those in WT mouse livers (Figure 4A). Furthermore, when liver MNCs from FcR–/– mice were stimulated with -GalCer, the production of IL-4, IL-10, IL-13, and IFN- was enhanced, as in MNCs from B6 mice (Figure 4B). Consistent with our in vitro experiments, the production of IL-4, IL-10, IL-13, and IFN- in sera from FcR–/– mice injected with -GalCer was also similar to that in sera from WT B6 mice (Figure 4C). These findings indicate that FcR-deficient NKT cells are functionally intact in terms of activation by -GalCer/CD1d complexes.

   Figure 4

Fc R -deficient NKT cells are activated by -GalCer. (A) Liver MNCs were freshly isolated from B6 or FcR–/– mice and analyzed for NKT cells by examining NK1.1 and TCR? expression using flow cytometry. The numbers of NK, NKT, CD4+, and CD8+ cells were also counted. (B) Liver MNCs were freshly isolated from B6 or FcR–/– mice and cultured with -GalCer (220 ng/ml) for 48 hours. The amounts of IL-4, IFN-, IL-10, and IL-13 in the culture supernatants were measured using ELISA. (C) B6 and FcR–/– mice were injected i.p. with -GalCer (1 μg in 300 μl PBS). Serum IL-4, IFN-, IL-10, and IL-13 levels were monitored using ELISA 12 hours after -GalCer injection. Data are mean ± SD for 3 mice per group. Similar results were obtained from 3 independent experiments.

To explore the mechanism by which surface FcRIII on NKT cells contributes to the development of arthritis, we used real-time PCR to measure the levels of IL-4, IFN-, and TGF-? in the synovia of CD1d–/– mice administered NKT cells from B6 or FcR–/– mice. Upon K/BxN serum transfer, CD1d–/– mice administered NKT cells from B6 mice showed a reduced level of TGF-?1 on day 10, as did B6 mice, whereas CD1d–/– mice administered NKT cells from FcR–/– mice showed an elevated level of TGF-?1, as did CD1d–/– mice (Figure 3D). Conversely, IFN- and IL-4 levels were lower in the joint tissues of CD1d–/– mice administered NKT cells from FcR–/– mice than in those administered NKT cells from B6 mice. In contrast to the levels in the joint tissues, the levels of TGF-?1, IL-4, and IFN- in the spleen were similar between CD1d–/– mice administered NKT cells from B6 and FcR–/– mice in the K/BxN serum transfer model. These results indicate that FcRIII engagement on NKT cells by IgG deposited in joint tissues enhances the production of IL-4 and IFN-, thereby supprssing TGF-?1 production, as previously reported (8).

    Discussion

Our study demonstrates that FcR-deficient NKT cells induce less antibody-induced arthritis than do NKT cells of wild-type mice, although the expression level of FcRIII on NKT cells is relatively low. These findings suggest that primarily FcRIII engagement, rather than TCR engagement, contribute to NKT cell activation in this K/BxN serum transfer model. To address this suggestion, the possibility that FcR-deficient NKT cells may be functionally defective in activating processes, thereby contributing the failure to induce arthritis in CD1d–/– mice, will need to be examined in future studies. The ability of FcR-deficient NKT cells stimulated with -GalCer to induce cytokine production in vitro and in vivo indicates that FcR-deficient NKT cells are functionally intact in terms of activation by -GalCer/CD1d complexes (Figure 4, B and C). Therefore, it is unlikely that the failure to induce arthritis in CD1d–/– mice injected with FcR-deficient NKT cells was attributable to functional defects in NKT cells. Alternatively, it may have been the results of a failure of FcR-deficient NKT cells to infiltrate joint tissues. However, the amount of V14J218 TCR mRNA in joint tissues of CD1d–/– mice administered B6 mouse NKT cells appeared to be similar to that of CD1d–/– mice administered FcR–/– mouse NKT cells in real-time PCR (Figure 3C). FcRIII+ NKT cells in the joint tissues are a mixed population consisting of iNKT and non-iNKT cells. Moreover, the concentration of V14J218 TCR mRNA in the joint tissues reflects the number of iNKT cells but not non-iNKT cells. Therefore, these findings indicate that FcR-deficient iNKT cells infiltrate the joint tissues during joint inflammation, much as B6 iNKT cells do. However, during K/BxN serum–transferred arthritis, both CD1d–/– and J218–/– mice showed mild inflammatory cell infiltration in ankle joints and surrounding connective tissues compared with wild-type B6 mice, and the in vivo activation of NKT cells using -GalCer aggravated joint inflammation (8). These previous results suggest that iNKT cells contribute to the promotion of joint inflammation in the K/BxN serum transfer model more than non-iNKT cells do. Therefore, the resistance to arthritis in the adoptive transfer experiments of FcR-deficient NKT cells into CD1d–/– mice was probably caused by the failure of NKT cell activation through FcRIII signals in the joint tissues.

Our present results revealed that FcRIII engagement by IgG in joint tissues provides activating signals to NKT cells in antibody-induced arthritis. It is generally believed that the engagement of TCR on NKT cells by -GalCer/CD1d provides primary activating signals for NKT cell activation in vitro and in vivo (3, 5). Molecules such as CD28, CD40, glucocorticoid-induced TNF receptor, and ICOS provide synergistic activating signals to NKT cells acting as costimulatory factors in the presence of simultaneous TCR engagement and thus modulate Th1/Th2 immune responses in vivo (23–25). Unlike these molecules, FcRIII induced NKT cell activation even in the absence of simultaneous TCR engagement in vitro, suggesting that FcRIII provides sufficient activating signals to NKT cells independently of TCR signals. The surface molecules expressed on T or NKT cells have not previously been reported to provide signals sufficient to activate these cells without simultaneous TCR engagement. Therefore our study elucidates, for the first time to our knowledge, the crucial role of FcRIII in NKT cell activation in the absence of simultaneous TCR stimulation in vivo.

Several prior reports demonstrated that FcR–/– mice are resistant to the induction or spontaneous onset of various autoimmune diseases (13, 26, 27), and NKT cells are critically involved in the development of these diseases (7, 8, 10). Those reports suggest that the activating function of FcRIII on NKT cells might not be confined to antibody-induced joint inflammation, but play critical roles in the development of various immune complex–associated autoimmune diseases.

To our knowledge, the activating process of NKT cells by FcRIII engagement has never been considered during the development of therapeutic approaches to antibody-induced joint inflammation. In the K/BxN serum transfer model, CSF-1–dependent macrophages induced the expression of inhibitory FcRIIB on CSF-1–independent effector macrophages, and this resulted in protection from antibody-induced arthritis by intravenous immunoglobulin (IVIG) (28). These findings suggest that FcRIIb on immune cells may be responsible for mediating protection by IVIG and further suggest that NKT cells may not be strong candidates for therapeutic approaches using IVIG in a K/BxN serum transfer model. Using combinatorial chemistry approaches, Marino et al. identified a peptide able to bind Ig and to interfere with FcR recognition (29). The administration of this peptide to MRL/lpr mice, a lupus animal model, resulted in a remarkable enhancement of survival rate, which suggested that treatment based on the administration of molecules capable of interfering with Ig/receptor recognition could provide notable therapeutic benefit. However, as far as NKT cells are concerned, the role of FcRIII on NKT cells has not previously been characterized to our knowledge in the development of lupus. Therefore, any potential therapeutic utility of targeting FcRIII on NKT cells in the treatment of lupus remains unknown and should be studied in the future. Unlike in lupus, a novel therapeutic approach targeted at specifically blocking FcRIII on NKT cells may be useful for modulating joint inflammation induced by NKT cells in autoantibody-induced arthritis.

In conclusion, the current study reveals that FcRIII engagement by IgG in joint tissues provides activating signals to NKT cells and thereby promotes antibody-induced joint inflammation.

    Methods

Mice. The KRN TCR transgenic mice and NOD mice were gifts from D. Mathis and C. Benoist (Harvard Medical School, Boston, Massachusetts, USA) and from the Institut de Genetique et de Biologie Moleculaire et Cellulaire, and were maintained in a B6 background (K/B). Arthritic mice (K/BxN) were obtained by crossing K/B with NOD (N) mice. The CD1d–/– mice were a gift from H. Gu (Columbia University, New York, New York, USA). The Fcer1g–/– (FcR–/–) mice of B6 background were purchased from Taconic. The B6 mice were purchased from Orient. These mice were bred and maintained under specific pathogen-free conditions at the Clinical Research Institute Seoul National University Hospital (CRISNUH), Seoul, Republic of Korea. All animal experiments were approved by the Institutional Animal Care and Use Committee at CRISNUH.

Cell line. DN32-D3 hybridoma (obtained from a V14+ TCR mouse with CD1d-specific NKT cells) were gifts from A. Bendelac (University of Chicago, Chicago, Illinois, USA) and were maintained in DMEM supplemented with 10% FBS and 5% of an antibiotic mix.

Flow cytometry. The mAbs used were FITC-conjugated 2.4G2, PE-conjugated anti–mouse CD25, PE-conjugated anti–mouse CD69, FITC- or PE-conjugated anti–mouse NK1.1, CyChrome-conjugated anti–mouse TCR-?, FITC-conjugated anti–mouse CD4, and CyChrome-conjugated anti–mouse CD8 (BD Biosciences). The FcRII-specific mAb (Ly17.2) was a generous gift from U. Hammerling (Memorial Sloan-Kettering Cancer Center, New York, New York, USA). Cells (1 x 106) were stained with mAbs for 30 minutes at 4°C.

Western blot. NKT cells sorted from B6 mouse liver and DN32-D3 cells were stimulated with and without heat-aggregated IgG, which was prepared by heating purified IgG at 63°C for 20 minutes. Proteins were eluted using extraction reagent (NE-PER Nuclear and Cytoplasmic Extraction Reagents; Pierce Biotechnology). Proteins were separated on SDS-PAGE and transferred to Nitrocellulose Membranes (Protran; Schleicher & Schuell Bioscience). Visualization was achieved using appropriate secondary Abs coupled to HRP, developed using the Abs indicated in Figure 2B and detected by ECL. Anti–GATA-3, anti–T-bet, anti-Syk, and anti-Lyn antibodies were purchased from Santa Cruz Biotechnology Inc. The anti-phosphotyrosine antibody, 4G10, was purchased from Upstate USA Inc.

ELISA. Sorted NKT cells (1 x 105 cells/well) were stimulated using the concentrations indicated in Figure 2, C–E, of anti-CD3 mAb and/or aggregated IgG or -GalCer for 48 hours. All cytokine ELISA kits were obtained from BD Biosciences, and assays were performed according to the manufacturer’s instructions. Standard curves were generated using known amounts of purified murine recombinant IL-4 (rIL-4), rIL-10, rIL-13, or rIFN- (BD Biosciences). The reaction was stopped with 3 N hydroxy acid, and absorbance was read at 450 nm and 570 nm.

Real-time PCR and RT-PCR analysis. For quantitative real-time PCR, total RNA was isolated from joint tissue homogenates using an RNeasy kit (Qiagen) according to the manufacturer’s instructions. RNA was reverse transcribed with MMLV-RT Taq polymerase (Koschem) prior to PCR. cDNA (1 μg) was amplified in the presence of a TaqMan universal master mix (PerkinElmer), gene-specific probes, the forward and reverse primers, and water. Gene-specific PCR products were measured using an Applied Biosystems 7500 Sequence Detection System (PerkinElmer, Applied Biosystems), and results for each cytokine were normalized to GAPDH expression. For real-time PCR, the following primers were synthesized by Applied Biosystems: GAPDH forward, TGCACCACCAACTGCTTA, reverse, GGATGCAGGGATGATGTT, and probe, CAGAAGACTGTGGATGGCCCCTC-VIC; IFN- forward, AGCAACAGCAAGGCGAAAA, reverse, CTGGACCTGTGGGTTGTTGA, and probe, CTCAAACTTGGCAATACTCATGAATGCATC-TAMRA; IL-4 primers used were PrimeScreen Mouse IL-4 Primer Pair and probe, FAM-CTCCGTGCATGGGGTCCCTTC–Black Hole Quencher (BioSource International); TGF-?1 forward, GCAACATGTGGAACTCTACCAGAA, reverse, GACGTCAAAAGACAGCCACTCA, and probe, ACCTTGGTAACCGGCTGCTGACCC-TAMRA; V14J218 TCR forward, GTGTGGTGGGCGATAGAGGT, reverse, ACAACCAGCTGAGTCCCAGC, and probe, FAM-CAGCCTTAGGGAGGCTGCATTTTGG-TAMRA.

For RT-PCR, the following primers were synthesized by Genotech Corp: FcRI forward, GTTAATTGCCACCAAGGCTGT, reverse, ACCTGTATTCGCCACTGTCC; FcRII forward, AGTCCAAGCCTGTCACCATC, reverse, CAGTTTTGGCAGCTTCTTCC; FcRIII forward, TGACACCCCATCCATCCTAT, reverse, CCCAGGATCTCACTGGGTTA; FcRIV forward, ATCTGCTCTAGAAGCATGTGGCAGCTACTA, reverse, CATGCGATAAGAGCTCACTTGTCCTGAGGT; V14J18 TCR forward, CTAAGCACAGCACGCTGCACA, reverse, AGGTATGACAATCAGCTGAGTCCC.

Serum transfer and arthritis scoring. Arthritic adult K/BxN mice were bled, and sera were pooled. Recipient mice were injected i.p. with 150 μl of pooled K/BxN sera on days 0 and 2 relative to the first injection. Ankle thickness was measured with a caliper (Manostat). Joint swelling was monitored and scored as follows: 0, no joint swelling, 1, swelling of a single finger joint, 2, mild swelling of a wrist or ankle, and 3, severe swelling of a wrist or ankle.

Adoptive transfer. Liver NKT cells were stained using PE-conjugated anti-NK1.1 and CyChrome-conjugated anti–TCR-? mAbs, and NK1.1+TCR-?+ NKT cells were sorted using FACStar Plus and CellQuest software (version 3.3; BD) to a purity of >98%. Sorted cells were adoptively transferred into CD1d–/– mice via intravenous injection 1 day before the first injection of K/BxN serum.

Histology. Joints were fixed in 10% formalin, decalcified by 10% EDTA in PBS for 3 days, embedded in paraffin, and sectioned, and tissue sections from knee joints were stained with hematoxylin and eosin.

Synthesis of -GalCer. -GalCer was synthesized using the method developed by Kim et al. (30).

Statistics. Statistical significance was analyzed using the Prism 3.0 program (GraphPad Software). To compare more than 2 groups, the 1-way ANOVA statistical analysis using Tukey test was performed. P values less than 0.05 were considered significant.

    Acknowledgments

The authors thank Seong Hoe Park for his support of this project, Kyeong Cheon Jung and Eun Young Choi for helpful comments on the manuscript, and all members of the Department of Experimental Animals at CRISNUH for animal management. We are also grateful to Uli Hammerling for providing FcRII-specific mAb (Ly17.2). This work was supported by a grant (R11-2002-098-05002-0) from the Korean Science and Engineering Foundation through the Rheumatism Research Center.

References

Lantz O. and Bendelac A. 1994. An invariant T cell receptor alpha chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4– 8– T cells in mice and humans. J. Exp. Med. 180:1097–1106.

Bendelac A. 1995. CD1: presenting unusual antigens to unusual T lymphocytes. Science. 269:185–186.

Kawano T., et al. 1997. CD1d-restricted and TCR-mediated activation of valpha14 NKT cells by glycosylceramides. Science. 278:1626–1629.

Chen H. and Paul W.E. 1997. Cultured NK1.1+ CD4+ T cells produce large amounts of IL-4 and IFN-gamma upon activation by anti-CD3 or CD1. J. Immunol. 159:2240–2249.

Taniguchi M., Harada M., Kojo S., Nakayama T., Wakao H. 2003. The regulatory role of Valpha14 NKT cells in innate and acquired immune response. Annu. Rev. Immunol. 21:483–513.

Beaudoin L., Laloux V., Novak J., Lucas B., Lehuen A. 2002. NKT cells inhibit the onset of diabetes by impairing the development of pathogenic T cells specific for pancreatic beta cells. Immunity. 17:725–736.

Singh A.K., et al. 2001. Natural killer T cell activation protects mice against experimental autoimmune encephalomyelitis. J. Exp. Med. 194:1801–1811.

Kim H.Y., et al. 2005. NKT cells promote antibody-induced joint inflammation by suppressing transforming growth factor ?1 production. J. Exp. Med. 201:41–47.

Kim J.H., et al. 2005. Natural killer T (NKT) cells attenuate bleomycin-induced pulmonary fibrosis by producing interferon-. Am. J. Pathol. 167:1231–1241.

Zeng D., Liu Y., Sidobre S., Kronenberg M., Strober S. 2003. Activation of natural killer T cells in NZB/W mice induces Th1-type immune responses exacerbating lupus. J. Clin. Invest. 112:1211–1222 doi: 10.1172/JCI200317165.

Gumperz J.E., et al. 2000. Murine CD1d-restricted T cell recognition of cellular lipids. Immunity. 12:211–221.

Ji H., et al. 2002. Arthritis critically dependent on innate immune system players. Immunity. 16:157–168.

Corr M. and Crain B. 2002. The role of FcgammaR signaling in the K/B x N serum transfer model of arthritis. J. Immunol. 169:6604–6609.

Takai T. 2002. Roles of Fc receptors in autoimmunity. Nat. Rev. Immunol. 2:580–592.

Koyasu S. 1994. CD3+ CD16+ NK1.1+ B220+ large granular lymphocytes arise from both alpha-beta TCR+ CD4– CD8– and gamma-delta TCR+ CD4– CD8– cells. J. Exp. Med. 179:1957–1972.

Unkeless J.C. 1979. Characterization of a monoclonal antibody directed against mouse macrophage and lymphocyte Fc receptors. J. Exp. Med. 150:580–596.

Takai T., Li M., Sylvestre D., Clynes R., Ravetch J.V. 1994. FcR gamma chain deletion results in pleiotrophic effector cell defects. Cell. 76:519–529.

Nimmerjahn F., Bruhns P., Horiuchi K., Ravetch J.V. 2005. FcgammaRIV: a novel FcR with distinct IgG subclass specificity. Immunity. 23:41–51.

Marcilla A., Rivero-Lezcano O.M., Agarwal A., Robbins K.C. 1995. Identification of the major tyrosine kinase substrate in signaling complexes formed after engagement of Fc gamma receptors. J. Biol. Chem. 270:9115–9120.

Crowley M.T., et al. 1997. A critical role for Syk in signal transduction and phagocytosis mediated by Fcgamma receptors on macrophages. J. Exp. Med. 186:1027–1039.

Szabo S.J., et al. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell. 100:655–669.

Ouyang W., et al. 1998. Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism. Immunity. 9:745–755.

Hayakawa Y., et al. 2001. Differential regulation of Th1 and Th2 functions of NKT cells by CD28 and CD40 costimulatory pathways. J. Immunol. 166:6012–6018.

Kaneda H., et al. 2005. ICOS costimulates invariant NKT cell activation. Biochem. Biophys. Res. Commun. 327:201–207.

Kim H.J., Kim H.Y., Kim B.K., Kim S., Chung D.H. 2006. Engagement of glucocorticoid-induced TNF receptor costimulates NKT cell activation in vitro and in vivo. J. Immunol. 176:3507–3515.

Butkiewicz L., Duriagin S., Laddach R., Chwalinska-Sadowska H., Jagodzinski P.P. 2005. Prevalence of Fc-gammaR chain expression in CD4+ T cells of patients with systemic lupus erythematosus. Scand. J. Rheumatol. 34:216–219.

Abdul-Majid K.B., et al. 2002. Fc receptors are critical for autoimmune inflammatory damage to the central nervous system in experimental autoimmune encephalomyelitis. Scand. J. Immunol. 55:70–81.

Bruhns P., Samuelsson A., Pollard J.W., Ravetch J.V. 2003. Colony-stimulating factor-1-dependent macrophages are responsible for IVIG protection in antibody-induced autoimmune disease. Immunity. 18:573–581.

Marino M., Ruvo M., De Falco S., Fassina G. 2000. Prevention of systemic lupus erythematosus in MRL/lpr mice by administration of an immunoglobulin-binding peptide. Nat. Biotechnol. 18:735–739.

Kim S.L.S., Lee T., Jung S., Kim D. 2004. Practical synthesis of KRN7000 form phytosphingosine. Synthesis. 22:847–850.