Literature
首页医源资料库在线期刊美国病理学杂志2007年第169卷第12期

Chronic Oxidative Stress Causes Amplification and Overexpression of ptprz Protein Tyrosine Phosphatase to Activate ??-Catenin Pathway

来源:《美国病理学杂志》
摘要:--------------------------------------------------------------------------------Oxidativestressisassociatedwithaplethoraofpathologicalconditions,includinginfection,inflammation,UVand-irradiation,andoverloadoftransitionmetalsandcertainchemicalcompounds。Chronictuberculous......

点击显示 收起

【摘要】  Ferric nitrilotriacetate induces oxidative renal tubular damage via Fenton-reaction, which subsequently leads to renal cell carcinoma (RCC) in rodents. Here, we used gene expression microarray and array-based comparative genomic hybridization analyses to find target oncogenes in this model. At the common chromosomal region of amplification (4q22) in rat RCCs, we found ptprz1, a tyrosine phosphatase (also known as protein tyrosine phosphatase or receptor tyrosine phosphatase ??) highly expressed in the RCCs. Analyses revealed genomic amplification up to eightfold. Despite scarcity in the control kidney, the amounts of PTPRZ1 were increased in the kidney after 3 weeks of oxidative stress, and mRNA levels were increased 16552-fold in the RCCs. Network analysis of the expression revealed the involvement of the ??-catenin pathway in the RCCs. In the RCCs, dephosphorylated ??-catenin was translocated to nuclei, resulting in the expression of its target genes cyclin D1, c-myc, c-jun, fra-1, and CD44. Furthermore, knockdown of ptprz1 with small interfering RNA (siRNA), in FRCC-001 and FRCC-562 cell lines established from the induced RCCs, decreased the amounts of nuclear ??-catenin and suppressed cellular proliferation concomitant with a decrease in the expression of target genes. These results demonstrate that chronic oxidative stress can induce genomic amplification of ptprz1, activating ??-catenin pathways without the involvement of Wnt signaling for carcinogenesis. Thus, iron-mediated persistent oxidative stress confers an environment for gene amplification.
--------------------------------------------------------------------------------
Oxidative stress is associated with a plethora of pathological conditions, including infection, inflammation, UV and -irradiation, and overload of transition metals and certain chemical compounds.1 Many epidemiological studies demonstrated a close association between chronically oxidative conditions and carcinogenesis. Chronic tuberculous pleuritis causes a high incidence of malignant lymphoma2 ; chronic Helicobacter pylori infection is associated with a high incidence of gastric cancer3 ; inflammatory bowel diseases are risk factors for colorectal cancer4 ; a high risk for heptocellular carcinoma is found in patients with genetic hemochromatosis5,6 ; exposure to asbestos fibers rich in iron is frequently associated with mesothelioma and lung cancer7 ; severe burn by UV radiation is a risk factor for skin cancer8 ; and -irradiation causes a high incidence of leukemia.9 As an initiation process under these circumstances and also as a coordinated strategy in proliferating tumor cells,10 oxidative stress appears to play a role in human carcinogenesis. Thus, an analysis that determines genomic and expressional alterations in an established oxidative stress-induced carcinogenesis is of great importance.
An iron chelate, ferric nitrilotriacetate (Fe-NTA) causes oxidative renal proximal tubular damage via a Fenton reaction that ultimately leads to a high incidence of renal cell carcinoma (RCC) in mice11 and rats12 after repeated intraperitoneal administration. This model is intriguing in that 1) more than half of the induced tumors metastasize to the lung and/or invade the peritoneal cavity, resulting in animal mortality13 ; 2) evidence exists for the involvement of free radical reactions in carcinogenesis, including not only covalently modified macromolecules (oxidatively modified DNA bases14,15 and lipid peroxidation products16,17 ) but also preventive action of -tocopherol against carcinogenesis18 ; and 3) genetic changes in p16INK4a tumor suppressor gene, especially large deletions,19,20 and expressional alteration of several key genes, including annexin 2 overexpression21 and also loss of thioredixn-binding protein-2 based on methylation of the promoter region,22 have been observed.
Here, we performed array-based comprehensive genomic hybridization and gene expression microarray analyses using Fe-NTA-induced rat RCCs and their cell lines to find amplified oncogenes in this model. A common chromosomal amplification at 4q22 in cancers resulted in the discovery of ??-catenin pathway activation via gene amplification and overexpression of ptprz1 protein tyrosine phosphatase.

【关键词】  oxidative amplification overexpression tyrosine phosphatase activate ??-catenin



Materials and Methods


Animal Experiments and Chemicals


The carcinogenesis study was performed as previously described13 using specific pathogen-free male Wistar rats (Shizuoka Laboratory Animal Center, Shizuoka, Japan) or male F1 rats hybrid between Fischer344 and Brown-Norway strains (Charles River, Yokohama, Japan). The animals were kept under close observation and were sacrificed when they showed persistent weight loss and distress. Histological grade of tumor was determined according to the modified World Health Organization classification as we previously described.13 The animal experiment committee of Graduate School of Medicine, Kyoto University approved this experiment. All of the chemicals used were of analytical quality.


Array-Based Comparative Genomic Hybridization


We performed array-based comparative genomic hybridization (CGH) with an Agilent 185K rat genome CGH microarray chip (Agilent Technologies, Santa Clara, CA), as described in the Agilent Oligonucleotide Array-based CGH for Genomic DNA Analysis Protocol ver. 4.0, and analyzed results with CGH Analytics Software (ver. 3.4). For each array, normal kidney tissue was used as a reference and labeled with Cy-3. Samples of interest were each labeled with Cy-5.


Ptprz1 Genome Copy Analysis


Genomic DNA was extracted with a DNA Extractor WB kit (Wako, Osaka, Japan). A Platinum SYBR Green qPCR SuperMix UDG kit (Invitrogen, Carlsbad, CA) and Real-time PCR system 7300 (Applied Biosystems, Foster City, CA) were used. Primer sequences were as follows, based on NW_047689: forward, 5'-CCTTACAGGTGAAAGTCAGC-3'; and reverse, 5'-GGTATACTTTGGCCCACAGT-3' (130-bp product).


Ptprz1 Genome DNA Fluorescent in Situ Hybridization


Three bacterial artificial chromosome clones (CH230C385 M3, CH 230C160 P8, CH 230C418 P21) were extracted with a big bacterial artificial chromosome DNA isolation kit (Princeton Separations, Adelphia, NJ), labeled with biotin-16-dUTP via nick translation (Roche, Tokyo, Japan) and used as probes (2 µg/ml) for hybridization in ULTRAhyb hybridization buffer (Ambion, Austin, TX) as previously described.20 Either formalin-fixed paraffin-embedded sections or cell lines were used on MAS-GP-coated glass slides (Matunami Glass Ind., Ltd., Kishiwada, Japan) after smear preparation.


Gene Expression Microarray


A total of 10 microarrays (Rat Genome 230 2.0; 31,999 genes; Affymetrix Inc., Santa Clara, CA) were used for screening purpose: two for each group of untreated control, Fe-NTA treatment for 1 week, Fe-NTA treatment for 3 weeks, Fe-NTA-induced RCCs with neither peritoneal invasion nor metastasis, and Fe-NTA-induced RCCs with pulmonary metastasis. Total RNA was isolated with Isogen (Nippon Gene Co. Ltd., Tokyo, Japan), and the degree of gene expression was then evaluated with GeneChip analysis (Focus array; Affymetrix) as previously described.23 Network analysis was performed using Ingenuity Pathways Analysis (Ingenuity Systems, Redwood City, CA).


RT-PCR


Total RNA was extracted with TRIzol (Invitrogen), and cDNA was synthesized using RNA PCR kit ver. 3.0 (Takara, Shiga, Japan) with random primers. We then amplified specific cDNA regions for each ptprz1 isoform with PCR based on a previous report24 and NM_013080. Primer sequences were as follows: primer set 1 for A, B, and S forms: forward, 5'-atgcgaatcctgcagagcttcc-3', and reverse, 5'-ggtcagcagacacctctttgtac-3' (1723-bp product); primer set 2 for A and S forms: forward, 5'-ggcctcgggttgtttatgaca-3', and reverse, 5'-tgtgtccgaagcagcatgaa-3' (1700-bp product); primer set 3 for A form: forward, 5'-tcagagcctgcgctctctgaca-3', and reverse, 5'-gtcaacagtgcagctctgcact-3' (1745-bp product); and primer set 4 for A and B forms: forward, 5'-ttaggtattacagcagacagctcc-3', and reverse, 5'-tcagactaaagactccaggctttc-3' (1737-bp product). For quantitative real-time PCR, a Platinum SYBR Green qPCR SuperMix UDG kit (Invitrogen) and Real-time PCR system 7300 (Applied Biosystems) were used. The glyceraldehyde 3-phosphate dehydrogenase gene was used as an internal control as previously described.23 PCR reactions for each target and control genes were performed in triplicate. Primer sequences used were as follows: ptprz1 based on NM_013080: forward, 5'-cccagctggtggttatgattcc-3', and reverse, 5'-cgtgactttgaagctctctcgcaa-3' (104-bp product); cyclinD1 based on NM_171992: forward, 5'-tgtgccatccatgcggaaa-3', and reverse, 5'-gacaagaaacggtccaggtagt-3' (114-bp product); c-myc based on NM_012603: forward, 5'-tgtctatttggggacagtgttc-3', and reverse, 5'-ctgttagcgaagctcacgtt-3' (149-bp product); c-jun based on NM_021835: forward, 5'-gtgaaatgacagctgagtgtctg-3', and reverse, 5'-gtcaacagtctggacttgtgg-3' (141-bp product); fra-1 based on NM_012953: forward, 5'-ctgctaagtgcagaaaccga-3', and reverse, 5'-caaggcgttccttctgctt-3' (129-bp product); and CD44 based on NM_012924: forward, 5'-tttggtggcacacagcttg-3', and reverse, 5'-atggaatacacctgcgtaacgg-3' (104-bp product).


Ptprz1 mRNA In Situ Hybridization


Phosphate-buffered formaldehyde-fixed, paraffin-embedded specimens were used as previously described25 using a DNA probe containing three repeats of ATT (underlined) at the 3' end for T-T dimer formation with an exposure to 10 kJ/m2 UV irradiation (5'-ctgagtatggcctcaaccagtgtgtcgtgaatgaagattattatt-3'). Minor modifications include pretreatment with 20 µg/ml proteinase K (37??C, 20 minutes), use of TDM-2 monoclonal antibody for T-T dimmer (1:4000 dilution),26 and an application of tyramide signal amplification biotin system (PerkinElmer Japan, Yokohama, Japan) for sensitive detection.


Cell Culture


Cells were cultured in Dulbecco??s modified Eagle??s medium (GIBCO, Rockville, MD) containing 5% (NRK52E; Health Science Research Resources Bank, Osaka, Japan) or 10% (FRCC-001 and FRCC-562 cell lines21 ) fetal bovine serum, 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin B at 37??C in a humidified 5% CO2 incubator.


Expression Vectors and Transfection


Coding sequence of rat ptprz1 (GenBank accession number NM_013080) was cloned by RT-PCR using cDNA of normal rat cerebrum as a substrate with the following primers: forward primer, 5'-ggggtaccccccacctggagatgcgaatcctgca-3' (KpnI), and reverse primer, 5'-gggggatatcccccttaccgtcaggtcatgggaagt-3' (EcoRV). PCR products were digested with KpnI and EcoRV (recognition sequences underlined) and subcloned into a mammalian expression vector pcDEF3,27 which was transfected into NRK52E cell line with Lipofectamine 2000 (Invitrogen) and selected with 400 to 800 µg/ml G418.


siRNA Experiments


We designed siRNA oligonucleotides through siDirect software.28 The target ptprz1 sequence was 5'-AACCCTTATGCACCAACTAGAAA-3' (6819C6841), and the siRNA was as follows: sense oligonucleotide, 5'-CCCUUAUGCACCAACUAGAAA-3', and antisense, 5'-UCUAGUUGGUGCAUAAGGGUU-3'. The target ??-catenin sequence was gagtcagcgacttgttcaaaact (1125 to 1147), and the siRNA was as follows: sense, 5'-GAGUCAGCGACUUGUUCAAAA-3', and antisense, 5'-UUGAACAAGUCGCUGACUCGG-3'. The negative control (NegC; Naito1) was as follows: sense, 5'-GUACCGCACGUCAUUCGUAUC-3', and antisense, 5'-UACGAAUGACGUGCGGUACGU-3' (RNAi Co., Ltd, Tokyo, Japan). FRCC-001 and FRCC-562 were seeded in the complete medium without antibiotics to 30 to 50% confluence, transfected with siRNA oligonucleotides with Lipofectamine 2000, and incubated for 48 to 72 hours to confirm gene expression with quantitative RT-PCR and Western blot analysis.


Fractionation, Immunoprecipitation, and Western blot


These were done as previously described22,29 except that 0.2 mmol/L Na3VO4, 50 mmol/L NaF, 1 mmol/L dithiothreitol, and 5.7 µg/ml aprotinine were included in the lysis buffer. Antibodies used were as follows: PTPRZ1 (clone 12; 1:100; BD Biosciences, San Jose, CA), ??-catenin (clone 14; 1:100), phosphotyrosine (06-427; 1:100; Upstate, Lake Placid, NY), phospho-??-catenin (Ser33/37/Thr41; 1:1000; Cell Signaling Technology, Danvers, MA), and proliferating cell nuclear antigen (clone PC10; 1:3000; BioGenex, San Ramon, CA).


Immunohistochemistry and Immunocytochemistry


This was performed as previously described22 with minor modifications. For the immunohistochemistry of paraffin-embedded specimens, the following antibodies were used: ??-catenin (clone 196621; 1:100; R&D Systems, Inc., Minneapolis, MN), c-myc (clone 9E10; 1:50; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), and cyclin D1 (SP4; 1:50; NeoMarkers, Inc., Fremont, CA). Antigen retrieval was performed by autoclaving at 121??C for 15 minutes in 10 mmol/L citrate buffer at pH 6.0. For the immunocytochemistry, cells grown on Lab-Tek II Chamber Slide w/Cover (Nalge Nunc International, Naperville, IL) at approximately 70% confluence were fixed with cold methanol for 10 minutes, followed by permeation with 0.5% Triton X-100 for 10 minutes at room temperature. The same antibody against ??-catenin was used at a dilution of 1:100. A tyramide signal amplification biotin system (PerkinElmer) was used to increase sensitivity. FITC-avidin and nuclear counterstaining with propidium iodide were used. Images were analyzed with confocal laser microscopy (Fluoview, Olympus, Osaka, Japan).


Cell Proliferation Analysis


Cells were seeded in a six-well plate at first in Dulbecco??s modified Eagle??s medium with serum but without antibiotics. After 24 hours, siRNA oligonucleotides for ptprz1 were transfected, followed by cell counting starting from 24 hours after transfection to the fifth day in triplicate.


Statistical Analysis


Statistical analyses were performed with an unpaired t-test in which P < 0.05 was considered as statistically significant.


Results


Array-Based CGH and Gene Expression Microarray Analyses Identified ptprz1 Amplification and Overexpression


We analyzed 13 Fe-NTA-induced rat RCCs and 2 cell lines established from them with array-based comparative genomic hybridization analyses. Chromosome 4q22 revealed the highest incidence of common genomic amplification among the 20 autosomes and X chromosome (Figure 1A) . Detailed reports of the whole CGH analyses will be published elsewhere (S. Akatsuka and S. Toyokuni, unpublished data). At the same time, we analyzed four primary RCCs (two nonmetastatic and two metastatic tumors) with gene expression microarray analyses (Tables 1 and 2 ; Gene Expression Omnibus accession number GSE7625). With the expression microarray analyses, ptprz1 was the fifth and sixth in the lists of up-regulated genes in nonmetastatic and metastatic RCCs, respectively, and was present on chromosome 4q22. Thus, we decided to focus on ptprz1 based on these two sets of data. Quantitative PCR analyses revealed that 7 of 11 primary RCCs showed genomic amplification of ptprz1 with 5 tumors showing more than fourfold increase (Figure 1B) . We used fluorescence in situ hybridization analyses to confirm the amplification. In high-copy number tumors, a significantly increased number of signals were observed, whereas control cells showed two or less. Data obtained from cell lines were clearer because of the optimal fixation (Figure 1C) .


Figure 1. Gene amplification of ptprz1 in Fe-NTA-induced RCCs. A: Array-based CGH analysis of 13 Fe-NTA-induced RCCs and 2 established cell lines, with profiles of chromosome 4 showing a broad peak at 4q22. Plus number at y axis indicates amplification at the chromosomal locus (log2 scale), whereas minus number indicates allelic loss; 0 is the normal 2N-state. Each color shows a different tumor. B: Copy number analysis by quantitative PCR. Eleven primary RCCs were analyzed. Means are shown after triplicate measurements that showed within 4% difference. Control, normal untreated kidney. C: Fluorescent in situ hybridization analysis of ptprz1 genome. a: Paraffin-embedded specimen of Fe-NTA-induced RCC. Control, normal untreated kidney. b: Cell lines. Original magnification: x160 (a); x400 (b). Control kidney and NRK52E nontransformed rat renal tubular cell lines showed two or fewer (tissue) signals in the nucleus (nuclear counterstaining by propidium iodide), whereas RCC and FRCC-562 cell line showed more than two signals. Representative images are shown.


Table 1. Top 20 Up- and Down-Regulated Genes in Nonmetastatic RCCs


Overexpression of ptprz1 Is Mainly of the B Isoform and Is Associated with Tumor Grade and Size


To differentiate three isoforms of ptprz1 reported,24 we designed specific primers for RT-PCR analyses (Figure 2A) and found that the B isoform is the major isoform in tumors (Figure 2B) . Thus, we focused on the B isoform. All of the primary RCCs examined showed 16552-fold increases in ptprz1 expression in comparison with that of a normal untreated kidney (Figure 2C) . In situ hybridization analyses confirmed the results, revealing abundant staining in the cytoplasm of RCC cells (Figure 2D) . At the protein level, repeated treatment of Fe-NTA for 3 weeks increased PTPRZ1 with a further increase in tumors (Figure 2E) . We compared four parameters (pulmonary metastasis, grade, peritoneal invasion and tumor size) of the primary RCCs with mRNA levels and found that morphological grade13 and size of the tumor were proportionally associated (Figure 2F) .


Figure 2. PTPRZ1 Isoform B is major in Fe-NTA-induced RCCs and is associated with tumor grade and size. A: Location of primers and mRNA hybridization probes in the ptprz1 cDNA. Primer set 1 is common to all of the isoforms (A, B, and S); primer set 2 is specific to A and S isoforms; primer set 3 is specific only to A isoform; primer set 4 is specific to A and B isoforms. B: RT-PCR analysis. B, brain; K, control kidney; T, Fe-NTA-induced RCC. Control kidney expressed undetectable amount of ptprz1 mRNA; major isoform in RCC was B isoform. A representative analysis is shown. C: Levels of ptprz1 expression. Registered numbers of RCCs in Figure 1B and C and E in this figure correspond to each other. Means are shown after triplicate measurements that showed within 11% difference. Control, normal untreated kidney. D: mRNA is situ hybridization analysis. RCC cells expressed abundant ptprz1 mRNA whereas control renal proximal tubules showed faint expression (original magnification, x80). E: Protein levels of ptprz1. For specific and sensitive detection, immunoprecipitation was performed. Fe-NTA-induced RCCs as well as kidney after chronic oxidative stress by Fe-NTA for 3 weeks showed induction of PTPRZ1. F: Association of ptptrz1 mRNA levels with tumor parameters. Tumor grade and size revealed a proportional association with ptprz1 expression (means ?? SEM, N = 3C10; *P < 0.05; **P < 0.01).


Overexpression of ptprz1 Activates ??-catenin Pathway


Because network analysis of gene expression microarray data pointed out the involvement of the ??-catenin signaling pathway, we studied the status of ??-catenin and its downstream genes such as cyclinD1, c-jun, c-myc, fra-1, and CD44 with quantitative PCR and immunohistochemistry. In the Fe-NTA-induced RCCs analyzed, all of the five ??-catenin downstream genes were overexpressed, whereas ??-catenin expression was not significantly increased (Figure 3A) . Paraffin-embedded specimens were used for immunohistochemistry. Weak immunostaining of ??-catenin was observed in the distal tubules of normal kidney but not in the proximal tubules where Fe-NTA-induced RCCs are believed to be originated, whereas RCCs showed moderate immunopositivity in the cytoplasm and weak to moderate immunopositivity in the nuclei, suggesting that ??-catenin abundance and translocation may play an important role in the downstream regulation. RCCs revealed weak to moderate immunopositivity of c-myc, and all of the RCCs showed strong nuclear immunopositivity for cyclin D1 (Figure 3B) . These results strongly indicated the involvement of ??-catenin pathway in the molecular mechanism of Fe-NTA-induced renal carcinogenesis. To demonstrate the causal relationship of ptprz1 and ??-catenin-downstream genes, we used cell culture systems thereafter.


Figure 3. ??-Catenin downstream genes are activated in Fe-NTA-induced RCCs. A: Expression of ??-catenin downstream genes in Fe-NTA-induced RCCs measured by quantitative PCR analysis. All of the five genes revealed significantly elevated expression, whereas expression of ??-catenin was not significantly changed. Control, normal untreated kidney (means ?? SEM, N = 3; *P < 0.05; **P < 0.01; ***P < 0.001). B: Immunohistochemical analysis of ??-catenin, c-myc, and cyclin D1. Weak immunostaining of ??-catenin was observed in the distal tubules of normal kidney, whereas RCC showed moderate immunopositivity in the cytoplasm and in the nuclei, suggesting that ??-catenin translocation may play an important role in the downstream regulation. RCC revealed moderate immunopositivity of c-myc and strong nuclear immunopositivity for cyclin D1. Representative images are shown. Control, normal untreated kidney. Specimens for control and RCC are serial sections, respectively. Refer to results for details (original magnification, x80).


Firstly, we evaluated the interaction of PTPRZ1 and ??-catenin by the use of a nontransformed rat renal tubular cell line (NRK52E) and two Fe-NTA-induced rat RCC cell lines (FRCC-001 and FRCC-562).21 We observed the presence of PTPRZ1 and the interaction of the two proteins only in the RCC cell lines (Figure 4A) . Next, we performed ptprz1 transfection to NRK52E cells and found that nuclear dephosphorylated ??-catenin was significantly increased and that tyrosine, but not serine/threonine, residues were the target amino acid for dephosphorylation (Figure 4, B and C) . This was accompanied by the expressional increase in the ??-catenin downstream target genes such as cyclinD1, c-jun, c-myc, fra-1, and CD44, which was abolished with the simultaneous transfection of ??-catenin siRNA, demonstrating that PTPRZ1 is upstream of ??-catenin (Figure 5A) . Furthermore, we performed an siRNA transfection study of ptprz1 in the two RCC cell lines. With this procedure, nuclear ??-catenin was significantly decreased with a relative increase in phosphorylated ??-catenin at tyrosine (Figure 4B) . This was accompanied by a marked expressional decrease in the ??-catenin target genes (Figure 5, B and C) . As seen by the nuclear presence of unphosphorylated ??-catenin and the expressional increase in ??-catenin downstream target genes, the endpoints were associated with cell proliferation and the levels of proliferating cell nuclear antigen (Figure 5, DCG) .


Figure 4. PTPRZ1 dephosphorylates tyrosine residues of ??-catenin for nuclear translocation. A: Interaction of PTPRZ1 and ??-catenin. NRK52E, nontransformed rat renal tubular cell line; FRCC-001 and FRCC-562 cell lines established from Fe-NTA-induced rat RCCs. PTPRZ1 is overexpressed only in FRCC cell lines and is associated with ??-catenin. B: Tyrosine, but not serine or threonine, residues of ??-catenin are the substrate of PTPRZ1 in association with nuclear translocation of ??-catenin. C: Transfection of ptprz1 induces nuclear translocation of ??-catenin (fluorescein isothiocyanate; nuclear counterstaining by propidium iodide; original magnification, x400).


Figure 5. Function of ??-catenin is regulated by ptprz1. ACC: Expression of ??-catenin downstream genes is dependent on the levels of ptprz1 expression. In NRK52E cells (A), transfection of ptprz1 caused induction of ??-catenin downstream genes, and this was reversed by specific knockdown of ??-catenin. In FRCC-001 (B) and FRCC-562 (C) cells, specific knockdown of ptprz1 caused down-regulation of ??-catenin downstream genes. In ACC, means are shown after duplicate measurements that showed within 12% difference. D: Expressional levels of ptprz1 are associated with protein levels of proliferating nuclear antigen (PCNA), a marker of cell proliferation. ECG: Expression levels of ptprz1 are associated with cell proliferation. NegC, negative control (means ?? SEM, N = 3; *P < 0.05, **P < 0.01).


Discussion


The biological significance of oxidative stress resulting from the continuous consumption of oxygen has become more and more important with respect to the increase in human lifetime. Oxidative stress can induce two completely different outcomes depending on the extent and the situation, namely cell death or proliferation.30,31 Cancer, one of the major causes of mortalities in the world, may be interpreted as a futile evolutionary effort on cellular proliferation under the given environment. Here, we undertook to obtain the responsible genetic alterations during carcinogenesis out of the selective process via chronic oxidative stress. In the established animal model of oxidative stress-induced carcinogenesis,5,12,32 we found for the first time that oxidative stress amplifies certain specific chromosomal regions in vivo using array-based comprehensive CGH analysis.


Previously, Hunt et al33 reported that chronic exposure of HA1 fibroblasts to increasing concentrations of H2O2 or O2 causes catalase gene amplification with increased amounts of message and protein and also discussed the results in association with the resistance against chemotherapeutic drugs in which pharmacological effects depend on oxidative stress. Our present findings are distinct from theirs in the following contexts: 1) gene amplification occurred in nonimmortalized cells in vivo at multiple different locations, suggesting either the presence of episomal/double minute chromosomes or multiple integration, and 2) the amplified genes were not necessarily associated with resistance to chronic oxidative stress. This is of note, considering the fact that a certain population of human cancers presents gene amplification, including the HER-2/neu proto-oncogene in breast cancers.34,35 The results indicate that persistent oxidative stress is one of the driving forces for gene amplification.


We have integrated the results from CGH analysis and gene expression microarray analysis and focused on ptprz1 (also called protein tyrosine phosphatase or receptor protein tyrosine phosphatase ??) in the present study. All of the 13 Fe-NTA-induced RCCs and two cell lines showed overexpression of ptprz1, whereas approximately one-half of them acquired gene amplification. Overexpression of ptprz1 was observed after as early as 3 weeks of persistent oxidative stress. These results suggest that overexpression and the possible associated open chromatin structure are necessary but probably not enough for the gene amplification. Other possible factors involved are neighbor gene effect and chromosome territory. It is now believed that genomic DNA corresponding to certain chromosomes shares a rather fixed stereographical position in nuclei even in interphase.36,37 Thus, a three-dimensional understanding of the neighboring genes would be necessary to understand fully the mechanism of gene amplification. Recently, we found that there are fragile sites (oxidative DNA base modifications) against oxidative stress in the genome using a novel method of DNA immunoprecipitation.15 Genome replication, repair, and recombination should further be considered to elucidate the gene-amplifying mechanism. This carcinogenesis model presents an ideal material for further investigation.


We performed functional analyses on ptprz1 expression using an untransformed rat renal tubular cell line and two cell lines derived from Fe-NTA-induced rat RCCs. Ptprz1 mRNA was abundantly expressed in the cerebrum and cerebellum in rats but was extremely low in the heart, lung, liver, kidney, and stomach (approximately 1/100; data not shown). The major isoform of ptprz1 in this model was the B isoform, one of the major isoforms in adult brain,24 and chronic oxidative stress increased the expression of ptprz1 in the kidney. So far, we have not yet identified the core consensus sequences in the promoter region of ptprz1 that responded to chronic oxidative stress, but hypoxia-inducible factor-2 could be involved in this process because recent study suggested that hypoxia-inducible factor-2 overexpression is important in the development of renal carcinoma in patients with von Hippel Lindau tumor suppressor protein.38,39 The A isoform was present during the prenatal period of rat brain and decreased rapidly after birth. Isoform B is the most deficient in the modification with carbohydrates among the three forms but retains cytoplasmic phosphatase domain.24 With this information, we decided to identify the signal pathways involved downstream of the B isoform.


We focused on the ??-catenin pathway because network analysis of the gene expression microarray data on RCCs indicated the involvement of this pathway. The ??-catenin transcription coactivator is a key transducer of the Wnt signaling in the canonical pathway. In the absence of Wnt, a multiprotein destruction complex containing glycogen synthetase ??, axin, disheveled, casein kinase 1, and adenomatous polyposis coli facilitates ??-catenin degradation by the proteasome.40 In our results, we add a novel switching mechanism of this pathway.


In the previous reports, function of ptprz1 in cancer has been controversial. Meng et al reported that pleiotrophin,41 a platelet-derived growth factor-inducible cytokine and a proto-oncogene, interacts with PTPRZ1 in a glioblastoma cell line (U373-MG) to inactivate its catalytic activity, leading to an increase in the tyrosine phosphorylation levels of ??-catenin.42 In contrast, it was recently reported that targeting of PTPRZ1 with a monoclonal antibody delays tumor growth in a glioblastoma model.43,44 We found that modulation of tyrosine phosphorylation in ??-catenin controlled by ptprz1 is a key process of the ??-catenin pathway in this model. Activation of neither pleiotrophin nor Wnt signaling (Wnt2b, Wnt4, or Wnt5a) was observed (GEO accession number GSE7625; data not shown), but ??-catenin was translocated to the nucleus, and the downstream target genes of ??-catenin were activated in this model. This type of activation appears to be cell specific, considering the fact that normal renal proximal tubular cells show undetectable levels of ptprz1 mRNA. Ptprz1 has recently been identified as important in the recovery from demyelinating lesions,45 is associated with susceptibility to VacA of Helicobacter pylori in murine stomach,46 and was up-regulated after hypoxia-inducible factor-2 transfection in HEK293T (adenovirus-transformed human fetal kidney cells).47 It is possible to interpret from our results that cancer cells use metabolisms similar to fetal tissues in that they proliferate rapidly in a hypoxic environment.48 2-18F-fluoro-2-deoxy-D-glucose, a radioactive derivative of glucose, is widely used for the diagnosis of cancer, based on the increased glucose consumption of cancer cells.49 Our previous observation in this carcinogenesis model that thioredoxin-binding protein-2 is inactivated via methylation of the promoter region, leading to the activation of glycolytic pathway via thioredoxin system,22,50 supports this hypothesis.


In conclusion, we show for the first time, to our knowledge, that chronic oxidative stress causes gene amplification in vivo through a combination of comprehensive array-based CGH and gene expression microarrray analyses in an oxidative stress-induced carcinogenesis model. Furthermore, we found a novel ??-catenin signal activation mechanism through overexpression of ptprz1 protein tyrosine phosphatase. Oxidative stress is closely associated not only with carcinogenesis but also with tumor biology.10,31 We believe that oxidative stress, especially of a chronic nature, presents an environment for competitive cell proliferation rather than cooperative cell survival, giving opportunities for selection. We do not know at present whether activation of the ??-catenin pathway through ptprz1 amplification is a specific event only in renal tubular cells or oxidative stress-induced carcinogenesis. Because gene amplification in human cancer is often associated with poor prognosis51 and is a mechanism of resistance to therapies,52 this animal model confers an intriguing opportunity not only for the elucidation of carcinogenesis toward cancer prevention but also of therapeutic resistance.


Table 2. Top 20 Up- and Down-Regulated Genes in Metastatic RCCs


Acknowledgements


We thank Dr. Masaharu Noda (National Institute for Basic Biology, Okazaki, Japan) for discussion. The pcDEF3 expression vector was a kind gift from Dr. Gerome A Langer (Robert Wood Johnson Medical School, Piscataway, NJ).


【参考文献】
  Halliwell B, Gutteridge JMC: Free Radicals in Biology and Medicine 2007 Oxford University Press, New York

Iuchi K, Ichimiya A, Akashi A, Mizuta T, Lee Y, Tada H, Mori T, Sawamura K, Lee Y, Furuse K, Yamamoto S, Aozasa K: Non-Hodgkin??s lymphoma of the pleural cavity developing from long-standing pyothorax. Cancer 1987, 60:1771-1775

Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi S, Yamakido M, Taniyama K, Sasaki N, Schlemper R: Helicobacter pylori infection and the development of gastric cancer. N Engl J Med 2001, 345:784-789

Eaden J, Abrams K, Mayberry J: The risk of colorectal cancer in ulcerative colitis: a meta-analysis. Gut 2001, 48:526-535

Toyokuni S: Iron-induced carcinogenesis: the role of redox regulation. Free Radic Biol Med 1996, 20:553-566

Elmberg M, Hultcrantz R, Ekbom A, Brandt L, Olsson S, Olsson R, Lindgren S, Loof L, Stal P, Wallerstedt S, Almer S, Sandberg-Gertzen H, Askling J: Cancer risk in patients with hereditary hemochromatosis and in their first-degree relatives. Gastroenterology 2003, 125:1733-1741

Hodgson J, Darnton A: The quantitative risks of mesothelioma and lung cancer in relation to asbestos exposure. Ann Occup Hyg 2000, 44:565-601

Nishigori C, Hattori Y, Toyokuni S: Role of reactive oxygen species in skin carcinogenesis. Antioxid Redox Signal 2004, 6:561-570

Preston D, Kusumi S, Tomonaga M, Izumi S, Ron E, Kuramoto A, Kamada N, Dohy H, Matsui T, Nonaka H, Thompson DE, Soda M, Mabuchi K: Cancer incidence in atomic bomb survivors: Part III. Leukemia, lymphoma and multiple myeloma, 1950C1987. Radiat Res 1994, 137:S68-S97

Toyokuni S, Okamoto K, Yodoi J, Hiai H: Persistent oxidative stress in cancer. FEBS Lett 1995, 358:1-3

Li JL, Okada S, Hamazaki S, Ebina Y, Midorikawa O: Subacute nephrotoxicity and induction of renal cell carcinoma in mice treated with ferric nitrilotriacetate. Cancer Res 1987, 47:1867-1869

Ebina Y, Okada S, Hamazaki S, Ogino F, Li JL, Midorikawa O: Nephrotoxicity and renal cell carcinoma after use of iron- and aluminum-nitrilotriacetate complexes in rats. J Natl Cancer Inst 1986, 76:107-113

Nishiyama Y, Suwa H, Okamoto K, Fukumoto M, Hiai H, Toyokuni S: Low incidence of point mutations in H-, K- and N-ras oncogenes and p53 tumor suppressor gene in renal cell carcinoma and peritoneal mesothelioma of Wistar rats induced by ferric nitrilotriacetate. Jpn J Cancer Res 1995, 86:1150-1158

Toyokuni S, Mori T, Dizdaroglu M: DNA base modifications in renal chromatin of Wistar rats treated with a renal carcinogen, ferric nitrilotriacetate. Int J Cancer 1994, 57:123-128

Akatsuka S, Aung TT, Dutta KK, Jiang L, Lee WH, Liu YT, Onuki J, Shirase T, Yamasaki K, Ochi H, Naito Y, Yoshikawa T, Kasai H, Tominaga Y, Sakumi K, Nakabeppu Y, Kawai Y, Uchida K, Yamasaki A, Tsuruyama T, Yamada Y, Toyokuni S: Contrasting genome-wide distribution of 8-hydroxyguanine and acrolein-modified adenine during oxidative stress-induced renal carcinogenesis. Am J Pathol 2006, 169:1328-1342

Toyokuni S, Uchida K, Okamoto K, Hattori-Nakakuki Y, Hiai H, Stadtman ER: Formation of 4-hydroxy-2-nonenal-modified proteins in the renal proximal tubules of rats treated with a renal carcinogen, ferric nitrilotriacetate. Proc Natl Acad Sci USA 1994, 91:2616-2620

Toyokuni S, Luo XP, Tanaka T, Uchida K, Hiai H, Lehotay DC: Induction of a wide range of C2C12 aldehydes and C7C12 acyloins in the kidney of Wistar rats after treatment with a renal carcinogen, ferric nitrilotriacetate. Free Radic Biol Med 1997, 22:1019-1027

Zhang D, Okada S, Yu Y, Zheng P, Yamaguchi R, Kasai H: Vitamin E inhibits apoptosis: DNA modification, and cancer incidence induced by iron-mediated peroxidation in Wistar rat kidney. Cancer Res 1997, 57:2410-2414

Tanaka T, Iwasa Y, Kondo S, Hiai H, Toyokuni S: High incidence of allelic loss on chromosome 5 and inactivation of p15INK4B and p16INK4A tumor suppressor genes in oxystress-induced renal cell carcinoma of rats. Oncogene 1999, 18:3793-3797

Hiroyasu M, Ozeki M, Kohda H, Echizenya M, Tanaka T, Hiai H, Toyokuni S: Specific allelic loss of p16INK4A tumor suppressor gene after weeks of iron-mediated oxidative damage during rat renal carcinogenesis. Am J Pathol 2002, 160:419-424

Tanaka T, Akatsuka S, Ozeki M, Shirase T, Hiai H, Toyokuni S: Redox regulation of annexin 2 and its implications for oxidative stress-induced renal carcinogenesis and metastasis. Oncogene 2004, 23:3980-3989

Dutta KK, Nishinaka Y, Masutani H, Akatsuka S, Aung TT, Shirase T, Lee W-H, Hiai H, Yodoi J, Toyokuni S: Two distinct mechanisms for loss of thioredoxin-biding protein-2 in oxidative stress-induced renal carcinogenesis. Lab Invest 2005, 85:798-807

Lee W, Akatsuka S, Shirase T, Kumar Dutta K, Jiang L, Liu Y, Onuki J, Yamada Y, Okawa K, Wada Y, Watanabe A, Kohro T, Noguchi N, Toyokuni S: -Tocopherol induces calnexin in renal tubular cells: another protective mechanism against free radical-induced cellular damage. Arch Biochem Biophys 2006, 453:168-178

Nishiwaki T, Maeda N, Noda M: Characterization and developmental regulation of proteoglycan-type protein tyrosine phosphatase zeta/RPTPbeta isoforms. J Biochem (Tokyo) 1998, 123:458-467

Yamamoto-Fukuda T, Aoki D, Hishikawa Y, Kobayashi T, Takahashi H, Koji T: Possible involvement of keratinocyte growth factor and its receptor in enhanced epithelial-cell proliferation and acquired recurrence of middle-ear cholesteatoma. Lab Invest 2003, 83:123-136

Hattori Y, Nishigori C, Tanaka T, Uchida K, Nikaido O, Osawa T, Hiai H, Imamura S, Toyokuni S: 8-Hydroxy-2'-deoxyguanosine is increased in epidermal cells of hairless mice after chronic UVB exposure. J Invest Dermatol 1996, 107:733-737

Goldman L, Cutrone E, Kotenko S, Krause C, Langer J: Modifications of vectors pEF-BOS, pcDNA1 and pcDNA3 result in improved convenience and expression. Biotechniques 1996, 21:1013-1015

Naito Y, Yamada T, Ui-Tei K, Morishita S, Saigo K: siDirect: highly effective, target-specific siRNA design software for mammalian RNA interference. Nucleic Acids Res 2004, 32:W124-W129

Toyokuni S, Kawaguchi W, Akatsuka S, Hiroyasu M, Hiai H: Intermittent microwave irradiation facilitates antigen-antibody reaction in Western blot analysis. Pathol Int 2003, 53:259-261

Toyokuni S, Akatsuka S: What has been learned from the studies of oxidative stress-induced carcinogenesis: proposal of the concept of oxygenomics. J Clin Biochem Nutr 2006, 39:3-10

Toyokuni S, Akatsuka S: Pathological investigation of oxidative stress in the postgenomic era. Pathol Int 2007, 57:461-473

Okada S: Iron-induced tissue damage and cancer: the role of reactive oxygen free radicals. Pathol Int 1996, 46:311-332

Hunt C, Sim J, Sullivan S, Featherstone T, Golden W, Von Kapp-Herr C, Hock R, Gomez R, Parsian A, Spitz D: Genomic instability and catalase gene amplification induced by chronic exposure to oxidative stress. Cancer Res 1998, 58:3986-3992

Slamon D, Clark G, Wong S, Levin W, Ullrich A, McGuire W: Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 1987, 235:177-182

Albertson D: Gene amplification in cancer. Trends Genet 2006, 22:447-455

Cremer T, Cremer C: Chromosome territories, nuclear architecture and gene regulation in mammalian cells. Nat Rev Genet 2001, 2:292-301

Meaburn KJ, Misteli T: Chromosome territories. Nature 2007, 445:379-381

Maranchie J, Vasselli J, Riss J, Bonifacino J, Linehan W, Klausner R: The contribution of VHL substrate binding and HIF1- to the phenotype of VHL loss in renal cell carcinoma. Cancer Cell 2002, 1:247-255

Kondo K, Klco J, Nakamura E, Lechpammer M, Kaelin W: Inhibition of HIF is necessary for tumor suppression by the von Hippel-Lindau protein. Cancer Cell 2002, 1:237-246

Clevers H: Wnt/beta-catenin signaling in development and disease. Cell 2006, 127:469-480

Chauhan A, Li Y, Deuel T: Pleiotrophin transforms NIH 3T3 cells and induces tumors in nude mice. Proc Natl Acad Sci USA 1993, 90:679-682

Meng K, Rodriguez-Pena A, Dimitrov T, Chen W, Yamin M, Noda M, Deuel T: Pleiotrophin signals increased tyrosine phosphorylation of beta-catenin through inactivation of the intrinsic catalytic activity of the receptor-type protein tyrosine phosphatase beta/zeta. Proc Natl Acad Sci USA 2000, 97:2603-2608

Foehr E, Lorente G, Kuo J, Ram R, Nikolich K, Urfer R: Targeting of the receptor protein tyrosine phosphatase beta with a monoclonal antibody delays tumor growth in a glioblastoma model. Cancer Res 2006, 66:2271-2278

Ulbricht U, Eckerich C, Fillbrandt R, Westphal M, Lamszus K: RNA interference targeting protein tyrosine phosphatase zeta/receptor-type protein tyrosine phosphatase beta suppresses glioblastoma growth in vitro and in vivo. J Neurochem 2006, 98:1497-1506

Harroch S, Furtado G, Brueck W, Rosenbluth J, Lafaille J, Chao M, Buxbaum J, Schlessinger J: A critical role for the protein tyrosine phosphatase receptor type Z in functional recovery from demyelinating lesions. Nat Genet 2002, 32:411-414

Fujikawa A, Shirasaka D, Yamamoto S, Ota H, Yahiro K, Fukada M, Shintani T, Wada A, Aoyama N, Hirayama T, Fukamachi H, Noda M: Mice deficient in protein tyrosine phosphatase receptor type Z are resistant to gastric ulcer induction by VacA of Helicobacter pylori. Nat Genet 2003, 33:375-381

Wang V, Davis D, Haque M, Huang L, Yarchoan R: Differential gene up-regulation by hypoxia-inducible factor-1 and hypoxia-inducible factor-2 in HEK293T cells. Cancer Res 2005, 65:3299-3306

Nodwell A, Carmichael L, Ross M, Richardson B: Placental compared with umbilical cord blood to assess fetal blood gas and acid-base status. Obstet Gynecol 2005, 105:129-138

Endo K, Oriuchi N, Higuchi T, Iida Y, Hanaoka H, Miyakubo M, Ishikita T, Koyama K: PET and PET/CT using 18F-FDG in the diagnosis and management of cancer patients. Int J Clin Oncol 2006, 11:286-296

Oka S, Liu W, Masutani H, Hirata H, Shinkai Y, Yamada S, Yoshida T, Nakamura H, Yodoi J: Impaired fatty acid utilization in thioredoxin binding protein-2 (TBP-2)-deficient mice: a unique animal model of Reye syndrome. FASEB J 2005, 147:733-743

Chung C, Ely K, McGavran L, Varella-Garcia M, Parker J, Parker N, Jarrett C, Carter J, Murphy B, Netterville J, Burkey B, Sinard R, Cmelak A, Levy S, Yarbrough W, Slebos R, Hirsch F: Increased epidermal growth factor receptor gene copy number is associated with poor prognosis in head and neck squamous cell carcinomas. J Clin Oncol 2006, 24:4170-4176

Cullen K, Newkirk K, Schumaker L, Aldosari N, Rone J, Haddad B: Glutathione S-transferase pi amplification is associated with cisplatin resistance in head and neck squamous cell carcinoma cell lines and primary tumors. Cancer Res 2003, 63:8097-8102


作者单位:From the Departments of Pathology and Biology of Diseases* and Urology, Graduate School of Medicine, Kyoto University, Kyoto; Medical Proteomics, and Inflammation and Immunology, Graduate School of Medicine, Kyoto Prefectural University of Medicine, Kyoto; the Biochemistry Division,¶ National C

作者: Yu-Ting Liu*, Donghao Shang, Shinya Akatsuka*, Hir 2008-5-29
医学百科App—中西医基础知识学习工具
  • 相关内容
  • 近期更新
  • 热文榜
  • 医学百科App—健康测试工具