Staphylococcus aureus Express Unique Superantigens Depending on the Tissue Source

¹Immunology Program, Graduate School of Medical Sciences, Departments of ²Medicine, Division of Hematology-Oncology, ³Pathology, and ⁴Pediatrics, Weill Medical College, Cornell University, and ⁵Rockefeller University, New York, New York

Received 8 July 2002; revised 5 September 2002; electronically published 13 December 2002.

     Human studies and protocols were approved by institutional review boards.
     Financial support: National Institutes of Health (grant AI-22333; National Institute on Drug Abuse supplement to D.N.P.; training grant GM-08466 to M.C.B).
     Reprints or correspondence: Dr. David N. Posnett, Dept. of Medicine, Box 56, Cornell University Weill Medical College, 1300 York Ave., New York, NY 10021 ().

     Superantigens (SAGs) are 25-kDa enterotoxins produced by microorganisms such as Staphylococcus aureus, Streptococcus pyogenes (group A), Yersinia pseudotuberculosis, and Mycoplasma arthritidis [1]. The staphylococcal toxins cause toxic shock syndrome (TSS) and food poisoning. SAGs are distinguished from conventional antigens. They do not require processing by antigen-presenting cells and bind to major histocompatibility complex class II at the cell surface at molecular sites other than the peptide-binding groove. They stimulate T cells based on the T cell receptor V gene expressed. This property explains their remarkable potency. Because relatively large percentages of T cells usually share expression of the same V gene, 10% of all T cells may respond to a given SAG. By contrast, the frequency of T cells responding to a nominal antigen is on the order of 10^-5. The resulting high levels of cytokines stimulated by SAGs are thought to be the main cause of clinical toxic shock.

     S. aureus has at least 15 SAG genes, but there are only limited data available on the distribution of these genes among S. aureus clinical isolates [2], and these studies did not examine the frequencies of the most recently described SAG genes. We know that isolates from patients with TSS always encode an SAG and frequently encode TSS toxin1 (TSST1). However, little is known about other SAG genes.

     Do S. aureus isolates differ in expression of these genes depending on whether they are associated with menstrual versus nonmenstrual TSS? Do SAG genes in isolates from patients with TSS differ from those in other S. aureus isolates and do they differ depending on tissue source? To answer some of these questions, we undertook a genomic survey of S. aureus isolates obtained at random from the clinical microbiology laboratories of a major metropolitan hospital. We tested for the presence of 12 SAG genes by polymerase chain reaction (PCR). Here, we describe our findings.

PATIENTS, MATERIALS, AND METHODS

     Patients and samples.     The following S. aureus control isolates (expressing known SAGs) were obtained from A. C. Lee Wong (University of Wisconsin, Madison): FRI 1042 (staphylococcal enterotoxin [SE] B), FRI 472 (SED), FRI 326 (SEE), FRI 572 (SEG), and FRI 445 (SEI). Other isolates (designated "BS"), obtained from the clinical microbiology laboratory of New York Hospital, were selected at random solely on the basis of positive identification of S. aureus. Isolates from patients with TSS were obtained from 2 sources: 8 isolates from 1983 were contributed by one of the authors (J.B.Z.) and have been described elsewhere [3]; 4 TSS isolates were obtained from patients at New York Hospital: DE and CV were from pediatric patients with typical TSS, whereas BS44 and BS62 were from adult immunodeficient patients with an atypical presentation of TSS [4].

     S. aureus isolates were obtained on brain-heart infusion (BHI) slants and subcloned on BHI agar plates prior to preparation of glycerol preps for storage. To prepare bacterial supernatants, the S. aureus isolates were thawed, and isolated colonies were cultured in Luria Bertani broth overnight. Bacteria then were pelleted by centrifugation in a microfuge, and supernatants were filtered through a 0.22-m filter. These supernatants were frozen at -70°C for later use at indicated dilutions (usually 10^-310^-6).

     PCR analysis for SAGs.     For PCR analysis of bacterial DNA, we used the following primers (53): SEA-F, TTGGAAACGGTTAAAACGAA; SEA-R, GAACCTTCCCATCAAAAACA (121-bp fragment amplified); SEB-F, TCGCATCAAACTGACAAACG; SEB-R, GCAGGTACTCTATAAGTGCC (477-bp fragment amplified); SEC-F, GTAATTTTGATATTCGCACT; SEC-R, TCATCTTTGTACTTCTTTGC (293-bp fragment amplified); SED-F, CTAGTTTGGTAATATCTCCT; SED-R, TAATGCTATATCTTATAGGG (318-bp fragment amplified); SEE-F, TAGATAAAGTTAAAACAAGC; SEE-R, TAACTTACCGTGGACCCTTC (169-bp fragment amplified); TSST1-F, ATGGCAGCATCAGCTTGATA; TSST1-R, TTTCCAATAACCACCCGTTT (350-bp fragment amplified); SEG-F, ACGTCTCCACCTGTTGAAGG; SEG-R, TGAGCCAGTGTCTTGCTTTG (400-bp fragment amplified); SEH-F, TTTCATTCACATCATATGCG; SEH-R, AAATCATTGCCACTATCACC (184-bp fragment amplified); SEI-F, TTGATACTGGAACAGGACAAGC; SEI-R, ACACCAATATCACCTTGAGC (239-bp fragment amplified); SEJ-F, CTTTAGTTTACAGCGATAGC; and SEJ-R, TTATCTTTTCAGAGATACCC (138-bp fragment amplified).

     We used previously characterized bacterial isolates as positive controls. A molecular clone, pZS2607, carrying SEJ [5] was also used as a control. An S. pyogenes isolate associated with TSS and various Staphylococcus epidermidis isolates were used as negative controls. Every experiment was run with both negative and positive controls. The PCRs were optimized in each case. In general, the 50-L reactions contained 1.53.5 M Mg, 0.2 U of Taq polymerase, 0.2 M dNTPs, and 1025 pmol of primer and were run for 36 cycles at 94°C for 1 min, 4253°C for 1 min, and 72°C for 1 min.

     [³H]thymidine assay for SAG biologic activity.     Peripheral blood lymphocytes (PBLs) were obtained from healthy subjects by Ficoll-Paque (Pharmacia) separation. The cells were washed 3 times in Hanks' medium and resuspended in RPMI 1640 medium with 10% fetal calf serum (FCS), antibiotics, and glutamine, at 10⁶ cells/mL for culture, with bacterial supernatants diluted to 10^-310^-6. Cultures were checked for cell viability, which was usually >70% by trypan blue exclusion (toxicity of the supernatants was only observed at lesser dilutions). On day 3 of culture, cells were pulsed with 1 Ci of [³H]thymidine (New England Nuclear) for 6 h and harvested onto filter mat glass fiber filter paper by cell harvester (Wallac). Beta emission was counted by betaplate liquid scintillation counter (Wallac).

     V stimulation assay for biologic activity of SAG.     PBLs were obtained from healthy subjects and cultured at 10⁶ cells/mL with dilutions of recombinant (r) SEG and rSEI at 10^-310^-6. Cells were also incubated with medium alone or with SEB as a positive control. After 3 days, we added 25 U/mL interleukin-2. After a total of 7 days, cells were stained with monoclonal antibody (MAb) to various V determinants [6], as described elsewhere [7]. MAbs used were specific for V1 (clone BL37.2), V2 (E2.2E7.2), V3 (8F10), V5.1 (Immu157), V5.2 (36213), V6.7 (OT145), V7.1 (3G5.D5), V8 (MX3), V9.1 (FIN9), V11 (C21), V12 (S511), V13.1 (H131), V14 (CAS1.1.3), V16 (TAMAYA1.2), V17 (C1), V18 (BA62.6), V20 (Ell1.4), V21.3 (IG125), V22 (IMMU546), or V23 (HUT78#1). The cells were then washed 3 times and incubated with an optimal dilution of fluorescein isothiocyanatelabeled goat antimouse IgG antibody (Biosource International), followed by final washes and reading on a flow cytometer (EPICS II; Coulter).

     ELISA for human antibodies to SAG.     The assay was adopted from P. Schlievert (personal communication). We used SEA, SEB, SEC2, TSST1 (Toxin Technologies), rSEG (mMJB474), and rSEI (pMJB475), isolated as His-tagged proteins [8]. rSEG and rSEI were purified by growing bacteria MJB1323 and MJB1324, respectively (provided by S. Munson, University of Wisconsin, Madison), at 31°C in 1 L of Luria Bertani broth with ampicillin and kanamycin. The bacterial pellet was resuspended in 6 M GuHCl and stirred for 60 min. The lysate was centrifuged to harvest supernatant. The supernatant was mixed with Ni-NTA resin slurry (Qiagen) for 60 min, loaded into an empty column, and washed twice with 8 M urea, 0.1 M NaH₂PO₄, and 0.001 M Tris-Cl (pH 6.3). Recombinant protein was eluted with 4 washes of 8 M urea, 0.1 M NaH₂PO₄, and 0.001 M Tris-Cl (pH 5.9), followed by 4 washes of 8 M urea, 0.1 M NaH₂PO₄, and 0.001 M Tris-Cl (pH 4.5). All fractions were analyzed by SDS-PAGE. rSEG and rSEI were single bands at 28 and 25 kDa, respectively.

     Isolated proteins were coated onto plates (Nunc-Immuno ; Nalge Nunc International) at 1020 g/mL in 0.1 M NaCO₃ (pH 9.0) buffer at 37°C until the wells were dry. The plates then were blocked with 2% FCS in PBS with 0.05% Tween 20 for 2 h at 37°C and washed with the same buffer 3 times. Serial 2-fold dilutions of human serum were added, starting at a dilution of 1 : 20, and the plates were incubated for 2 h at 37°C. The plates were washed 3 times. Goat antihuman IgG heavy and light chain or isotype-specific anti-IgG, -IgA, or -IgM labeled with alkaline phosphatase (Sigma Chemicals) was added at a predetermined optimal titer of 1 : 5000, and plates were incubated at 37°C for 2 h. The plates were washed 3 times and incubated with 50 L of p-nitrophenylphosphate substrate until visible color change occurred. Absorbance was read at a wavelength of 405 nm. Titers corresponding to a 50% decrease in optical density levels were calculated by extrapolation based on a positive control sigmoid-binding curve of serum dilutions.

RESULTS

     Establishing PCRs specific for individual SAGs.     SAG genes may have considerable homology with one another. Therefore, specific PCRs able to distinguish S. aureus reference isolates were set up and used along with positive and negative controls.  demonstrates that these PCRs are able to specifically detect the presence of individual SAG genes in the bacterial genome. Cross-reactions were not detected. Usually, there were no contaminant bands; the expected size of the amplification fragments was observed, based on comparisons with markers. The PCR results could be reliably confirmed in independent experiments and when using DNA preparations from sequentially subcloned colonies. B shows how the highly homologous SEC1-3 could be distinguished on the basis of digestion of PCR products with 2 restriction enzymes, RsaI and HincII. The isolates BS51 and DE contained SEC3 and SEC2, respectively.

fig.ommitted

Figure 1.        Results of novel polymerase chain reactions (PCRs) to detect Staphylococcus aureus superantigen (SAG) genes. A, Ten novel PCRs for detection of genomic SAG genes. Dashes, S. aureus DNA from control isolates were negative for all tested SAG genes. PCR showed no extraneous bands and no cross-amplification of related SAG genes. B, Distinction between staphylococcal enterotoxin (SE) C1SEC3. PCR products obtained with SEC primers had to be digested with RsaI and HincII to obtain restriction enzyme patterns specific for the 3 SEC subtypes. Undig., undigested.

     S. aureus isolates from patients with TSS contain multiple SAG genes.     Twelve isolates from patients with staphylococcal TSS were examined (). As expected, these isolates contained many SAG genes. The isolates had 3 features in common. First, they tended to have a high number of SAG genes per bacterial isolate (). Second, TSST1 was frequently present (), which is consistent with prior results [2]. Third, SEG and SEI were frequently present (), which is consistent with a recent report [9].

fig.ommitted

Figure 2.        Results of polymerase chain reactions (PCRs) on genomic bacterial DNA by isolate (grouped by source). Control isolates at top were used as standards to set up the PCRs. TB, group A Streptococcus pyogenes from a patient with streptococcal toxic shock syndrome (TSS) was used as an additional negative control. Positive PCRs are highlighted by hatched background (TSS toxin 1), dotted background (staphylococcal enterotoxin [SE] G and SEI), or gray background (all other superantigens). 1 or +, Positive PCR result; abd., abdominal; art. dis., artery disease; BAL, bronchoalveolar lavage; bx, biopsy; CA, carcinoma; cath, catheter; DKA, diabetic ketoacidosis; eye R, right eye; HIV, human immunodeficiency virus; intest., intestinal; Leuk., leukemia; L heal, left heal; MI, myocardial infarction; MRSA, methicillin-resistant Staphylococcus aureus; NA, not applicable; PEJ, percutaneous enterojejunal tube; perit., peritoneal; SLE, systemic lupus erythematous; s/p, status post; staph, staphylococcus; surg, surgical.

fig.ommitted

Table 1.          Staphylococcus aureus superantigen (SAG) genes, by isolate group.

     The isolates from patients with TSS were a mixed collection. Eight were obtained at the height of a TSS epidemic in 1983 [3]; 4 were recent isolates; 6 were from cases of menstrual TSS; 6 were from cases of nonmenstrual TSS; and 2 were from immunodeficient patients with atypical presentation of TSS [4]. There was no obvious correlation with these clinical groups in terms of SAG genes found by PCR. In most cases, the clinical expression of TSS could be explained by the presence of those toxins thought to mainly associate with TSS, namely TSST1, SEB, SEC [10], and SEG, SEI [9].

     S. aureus isolates from female genital mucosa preferentially encode SEG and SEI.     Several points can be made with regard to the PCR results for non-TSS isolates (). First, the overall frequency of SAG-positive isolates was >50% (). This is high, compared with frequencies in prior reports. The real frequency may be even higher, because new SAG genes are still being discovered [11, 12]. Indeed, rare isolates that gave negative results in all of our PCRs still produced supernatants with strong T cell stimulatory activity (bioassay for SAG), as discussed below.

     Second, isolates that contained several SAG genes were quite common. This applied in particular to S. aureus isolates from female genital sites () but also to TSS isolates. Because TSS is thought to occur in persons who lack neutralizing antibodies to the SAG toxins [2], bacteria with several SAG genes would be more likely to encounter a host lacking antibodies to any one of these SAG. Thus, selection for a group of isolates able to cause TSS symptoms may explain the high number of SAG genes in these isolates. However, it is not readily clear how selection may have occurred for the genital isolates with high numbers of SAG genes. By following the same argument, one might conclude that neutralizing antibodies to SEG, SEI, and TSST1 are less prevalent. This prediction was confirmed by the data (), which show that, on average, antibody titers to TSST1, SEG, and SEI are lower than titers to SEA, SEB, and SEC2.

fig.ommitted

Figure 3.        Antibody titers to staphylococcal enterotoxin (SE) G and SEI are higher in women. A, Mean inverse titers of antibodies in human serum to the indicated Staphylococcus aureus superantigen (SAG) were plotted (with SD) for healthy men and women. Significance for sex differences was calculated by t test. B, Percentage of serum samples with IgG, IgM, and IgA antibody titers to SEI/SEG above cutoff values for male and female donors. Statistical significance was calculated by Fisher's exact test. The selected cutoff values represent 50% of maximal optical density values obtained with serial dilution of a positive control serum. The cutoff titers were as follows: IgG anti-SEG, 1 : 480; IgM anti-SEG, 1 : 120; IgA anti-SEG, 1 : 10; IgG anti-SEI, 1 : 20; IgM anti-SEI, 1 : 20; and IgA anti-SEG, 1 : 10. C, Inverse titers of cord blood (CB) serum samples and average male and female titers for all 3 antibody isotypes to recombinant SEG and SEI. TSST1, toxic shock syndrome toxin 1.

     Third, bacteria from female genital sites frequently contained SEG and SEI ( and ). This observation implies selection for this type of S. aureus at this site.

     SAG genes are functional in vitro.     SAG proteins are powerful T cell stimulants that are active at concentrations as low as 10^-15 M. Naive T cells proliferate vigorously with a rapid response, peaking after 34 days, as with mitogens. In contrast, T cell responses to nominal antigens usually require priming, are only detectable after 57 days of culture, and, in general, are low proliferative responses. These properties of SAGs make it possible to examine nonpurified bacterial supernatants for mitogenic activity [13, 14]. Indeed, bacteria that lacked SAG genes by PCR did not stimulate T cells to proliferate in a 3-day culture (). Thus, under the conditions used, bacterial supernatants, which may contain many nominal antigens, do not stimulate T cell proliferation unless SAGs are present. S. aureus supernatants from bacteria with SAG genes were able to stimulate proliferation at dilutions of 10^-310^-6 or less (). This assay gave similar results with bacterial sonicates and with isolated recombinant SAGs (e.g., rSEG [data not shown] and rSEI []) expressed by transformed Escherichia coli. S. aureus containing either single SAG or various SAG combinations stimulated T cells. There was no correlation between the number of different SAG genes per bacterium and the degree of T cell stimulation. However, this is difficult to evaluate in the absence of data on SAG protein expression.

fig.ommitted

Figure 4.        Staphylococcus aureus superantigens (SAGs) as detected in a biologic assay ([³H]thymidine). Bacteria that contained SAG genes by polymerase chain reaction produce bioactive SAG. [³H]thymidine incorporation was measured in peripheral blood mononuclear cells after 3 days of culture with added supernatants from various bacterial isolates containing the indicated SAG. Supernatants were added at final dilutions of 10^-3, 10^-4, 10^-5, and 10^-6, corresponding to each of the 4 bars from left to right. His, histidine-tagged; SE, staphylococcal enterotoxin; TSST1, toxic shock syndrome toxin 1.

     There were some exceptions to these rules. A few bacterial supernatants had activity in the T cell stimulation assay, even though no SAG was detected by PCR (data not shown). This was consistent with the presence of SAG genes that were either not evaluated in this study or with SAG genes that have yet to be discovered. Some bacterial supernatants containing SAG DNA by PCR were unable to induce T cell proliferation (e.g., BS29 and BS30). We confirmed the presence of SEC2 in BS29 and BS30 in several PCRs, but the bacterial supernatant was unable to induce T cell proliferation in [³H]thymidine assays or by measuring expansion of V17 T cells known to be targeted by SEC2 [15]. We interpret these findings as evidence that SAG genes are sometimes not functionally expressed. Perhaps this is due to genetic variations and mutations or to regulation of SAG gene expression.

     SEG and SEI stimulate specific V genes.     To determine the V specificity of SEG and SEI, rSAG were added to PBL cultures at 10-fold dilutions of 10^-210^-6. T cells were stained after 7 days of culture with various MAbs to V gene products. SAG usually cause a shift of the targeted V subset into the blast population and an increase in total numbers of cells expressing the targeted V gene [15, 16]. For instance, SEI caused elevations of V1, V5.1, and V5.2 in the blast population, relative to the percentages in small resting T cells (). Likewise, SEG stimulated V3 and V14.

fig.ommitted

Figure 5.        V specificity of staphylococcal enterotoxin (SE) G and SEI. Peripheral blood mononuclear cells were stimulated with recombinant SEI and SEG expressed in Escherichia coli. Cultures were supplemented with interleukin-2 and analyzed by flow cytometry on day 7. The V repertoire in small resting (lymphs) and large blastic (blasts) cells is shown. Arrows, Specific stimulation of a V subset.

     In experiments addressing the V specificity of SAG, results may vary, depending on the assay and on the concentration of the SAG used [17]. Our results on the specificity of SEG and SEI differed slightly from data obtained with a reverse-transcriptase PCRbased assay [11]. To assess whether concentration of the SAG affected the results, we titered rSEG and rSEI to dilutions of 10^-6 and used the same assay shown in  (data not shown). For rSEG, both V3 and V14 stimulation titered out at a dilution of 10^-4. In contrast, the V-specific effects of rSEI were strikingly concentration dependent. V1 stimulation titered out at 10^-4, V5.1 at 10^-5, and V5.2 at <10^-7. Therefore, in the case of SEI, the observed V specificity depends greatly on its concentration.

     The SAG genes encoded in each S. aureus isolate vary tremendously . One cannot predict how much of each SAG protein is produced by these isolates or whether this depends on the presence of other SAG genes or on environmental conditions. In addition, T cells stimulated simultaneously by several SAGs together may respond differently than T cells stimulated by individual SAGs. Therefore, in vivo, the V-specific effects of any given SAG are likely to be variable.

     Women have evidence of higher antibody titers to SEG and SEI.     On the basis of the observation that S. aureus from female genital mucosa, but not other tissue sites, express SEG and SEI, we predicted that women would have higher exposure to SEG and SEI and, therefore, higher average titers of serum antibodies specific for these 2 SAGs. We measured serum titers of IgG antibodies by ELISA, specifically for SEA, SEB, SEC2, TSST1, SEG, and SEI. Age-matched healthy donors from the New York area were used for this purpose. The average ages of the healthy donors were 33.2 ± 7.8 years (distribution, 1747 years) for women and 34.3 ± 9.7 years (distribution, 2650 years) for men. IgG titers for SEA, SEB, SEC2, and TSST1 did not differ in men and women, but average titers against SEG and SEI were higher in women . The difference reached statistical significance for anti-SEI titers.

     Next we tested for IgM, IgA, and IgG antibodies to rSEI and rSEG . Women had high titers to rSEI and rSEG more frequently than men did. Although the trend was consistent regardless of antibody isotype , statistical significance was reached only for IgG and IgM titers to SEI.

     Cord blood (CB) may contain maternal IgG but not IgM or IgA. Therefore, we also analyzed 3 random CB serum samples . Two of 3 CB serum samples contained IgG antibodies to rSEI and rSEG, presumably of maternal origin. As expected, IgM and IgA antibodies were completely lacking. This proves that antibodies to these SAGs are acquired, as opposed to innate. Development of antibody titers in children and adults likely requires exposure to S. aureus producing these toxins.

DISCUSSION

     We present evidence that S. aureus from female genital mucosa express a different complement of SAG genes, frequently including SEG and SEI. This conclusion is based on 2 independent experimental results: PCR data on S. aureus isolates () and higher average antibody titers to SEG and SEI in women. The data point to similarities between S. aureus isolated from patients with TSS and those from female genital sourcesnamely, both have more SAG genes per bacterium, and they frequently contain SEG/SEI. The isolated bacteria encoded functionally intact SAGs with the clear potential for in vivo biologic effects. Thus, it seems possible that these SAG genes provide the bacteria with an adaptive mechanism suited to their environment.

     Role for SEG/SEI?     The genes for most SAGs are located on mobile genetic elements called pathogenicity islands (SaPIs) [18, 19]. TSST1 is located on SaPIn1. The genes for SEG and SEI are located within a cluster of SAG genes on SaPIn3. SaPIs can spread horizontally. They are excised, replicated, and encapsidated as phagelike particles and, finally, integrated as intact units by an integrase encoded within the SaPI itself [18]. This explains why the SEG and SEI genes are usually present together (). Bacterial strains associated with TSS appear to contain both pathogenicity islands, SaPIn1 and SaPIn3. Such strains would contain numerous additional toxin genes encoded on these islands. For instance, SaPIn3 also contains leukotoxins (lukD and lukE) and a series of secretory serine proteases (splAF) [19]. In addition to SAGs, these genes are also candidates that may provide S. aureus with adaptive mechanisms for survival in the environment of the genital mucosa.

     This may arguably be the first example in which S. aureus isolated from a particular tissue expresses an alternative set of SAG genes. As such, the data suggest that SEG/SEI provide bacteria with an advantage specific to the female genital mucosa. However, as discussed, SEG/SEI may serve solely as genetic markers for specific SaPIs.

     There is one other instance in which expression of specific SAGs may be associated with a specific infection: chronic mastitis in cows. These infections are persistent and resolve poorly [20, 21]. In one study, they were associated with S. aureus in 37% of cases [22]. Such isolates most frequently produce SEC, rather than other SAGs tested, on the basis of results of Southern blot and immunodiffusion with specific antiserum [23]. Here, SEC may serve as a marker for the presence of another pathogenicity island (e.g., SaPI4 or SaPIbov) [18].

     Are bacteria containing SEG/SEI adapted for genital colonization or invasion?     If SEG/SEI-containing S. aureus predominate in cultures from female genital mucosa, the question arises whether these genes themselves or other genes on SaPIn3 can facilitate colonization or invasion of the genital mucosa. SAG genes belong to the complement of genes expressed during the stationary phase of S. aureus growth in vitro [24], a phase thought to reflect in vivo tissue invasion. Indeed, SAGs are expressed along with other extracellular enzymes and toxins (lipase, V8 protease, leukocidin, staphylokinase, hemolysins, phospholipase, elastase, and hyaluronidase) that are likely to aid in tissue invasion. However, S. aureus isolates from patients with TSS make significantly fewer hemolysins, nucleases, and lipases than do isolates from wounds or nares [25]. Similar observations were made with vaginal isolates from healthy menstruating or nonmenstruating women [25]. Thus, these isolates may be less well endowed with secretory products that are thought to be important in tissue invasion. This is now better understood, because it has been shown that TSST1 and SEB are global repressors of exotoxin synthesis, and SAG-producing strains of S. aureus are apurulent, inhibit inflammation, and fail to produce an abscess when inoculated subcutaneously in mice [26].

     In our study, genital S. aureus was isolated most often from patients with vaginal discharge or a local infection. In most cultures, S. aureus was not the predominating microorganism, with the notable exception of BS49 and BS47 from patients with vaginitis, where methicillin-resistant S. aureus overgrew other bacterial species. Even though S. aureus is not a common pathogen in the vagina/cervix, we consider it possible that S. aureus may have contributed to the infection in the absence of any other known causative organism. If so, it remains possible that SEG/SEI may have facilitated invasion of the genital mucosa, leading to infection. Indeed, there is evidence that some SAGs can have striking effects on mucosal epithelia [27], presumed to be the cause of food poisoning, and that they can transcytose through unicellular epithelial layers [28] and stimulate T cells after transepithelial transport in mice [28].

     S. aureus can be isolated from normal female genital mucosa, especially during menstruation [2], or from used tampons. In one study, vaginal carriage of S. aureus was 7% in premenarchial and nonmenstruating women but 33% in menstruating women [2]. In another study [29], S. aureus carriage persisted for the duration of 3 menstrual cycles in 6 (35%) of 17 colonized women. This raises the possibility that S. aureus may occasionally colonize the female genital mucosa.

     There are quite obvious differences between female genital mucosa and other epithelia, in particular, the cyclical menstrual changes. S. aureus containing SEG/SEI genes might differ from other S. aureus strains when tested with relevant experimental variables such as pH, viscosity of vaginal mucus, content of antimicrobial enzymes (e.g., lysozyme) vaginal iron, lactoferrin, H₂O₂ produced by lactobacilli, oxidation-reduction potential, and local IgA and IgG antibodies. In an attempt to address these issues, we tested >70 cervicovaginal cultures from healthy nonmenstruating women seen for routine gynecologic examinations. Only 1 sample grew S. aureus. Of 12 SAG genes examined by PCR, this isolate contained SEG, SED, and SEA (data not shown). In summary, further studies are needed to examine how SEG/SEI or other genes of SaPIn3 provide S. aureus with an adaptive mechanism for growth in cervicovaginal tissues.

Acknowledgments

     We thank S. Munson for providing recombinant staphylococcal enterotoxin (SE) G and SEI constructs, Amy C. Wong for Staphylococcus aureus standard isolates, G. Stewart for an SEJ construct, Betty Panik for invaluable assistance in obtaining S. aureus isolates, Kristin Lee and Suzanne Brunzel for assistance, and S. Witkin for review of the manuscript.

References

1. 

Bernal A, Proft T, Fraser JD, Posnett DN. Superantigens in human disease. J Clin Immunol 1999; 19:14956. 

2. 

Chesney PJ. Toxic shock syndrome. In: Crossley KB, Archer GL, eds. The staphylococci in human disease. New York: Churchill Livingstone, 1997 50924.

3. 

Schutzer SE, Fischetti VA, Zabriskie JB. Toxic shock syndrome and lysogeny in Staphylococcus aureus. Science 1983; 220:3168.

4. 

Kamel NS, Banks MC, Dosik A, Ursea D, Yarilina AA, Posnett DN. Lack of muco-cutaneous signs of toxic shock syndrome when T cells are absent: S. aureus shock in immunodeficient adults with multiple myeloma. Clin Exp Immunol 2002; 128:1319.

5. 

Zhang S, Iandolo JJ, Stewart GC. The enterotoxin D plasmid of Staphylococcus aureus encodes a second enterotoxin determinant (sej). FEMS Microbiol Lett 1998; 168:22733.

6. 

Posnett DN, Romagne F, Necker A, Kotzin BL, Sekaly RP. Summary: first human TCR monoclonal antibody workshop. Immunologist 1996; 4:58.

7. 

Posnett DN, Kabak S, Hodtsev AS, Goldberg EA, Asch A. TCR-V subsets are not preferentially deleted in AIDS. AIDS 1993; 7:62531.

8. 

Munson SH, Tremaine MT, Betley MJ, Welch RA. Identification and characterization of staphylococcal enterotoxin types G and I from Staphylococcus aureus. Infect Immun 1998; 66:333748.

9. 

Jarraud S, Cozon G, Vandenesch F, Bes M, Etienne J, Lina G. Involvement of enterotoxins G and I in staphylococcal toxic shock syndrome and staphylococcal scarlet fever. J Clin Microbiol 1999; 37:24469.

10. 

Bohach GA, Fast DJ, Nelson RD, Schlievert PM. Staphylococcal and streptococcal pyrogenic toxins involved in toxic shock syndrome and related illnesses. Crit Rev Microbiol 1990; 17:25172.

11. 

Jarraud S, Peyrat MA, Lim A, et al. egc, A highly prevalent operon of enterotoxin gene, forms a putative nursery of superantigens in Staphylococcus aureus. J Immunol 2001; 166:66977.

12. 

Williams RJ, Ward JM, Henderson B, et al. Identification of a novel gene cluster encoding staphylococcal exotoxinlike proteins: characterization of the prototypic gene and its protein product, SET1. Infect Immun 2000; 68:440715. 

13. 

Kappler JW, Herman A, Clements J, Marrack P. Mutations defining functional regions of the superantigen staphylococcal enterotoxin B. J Exp Med 1992; 175:38796. 

14. 

Hurley JM, Shimonkevitz R, Hanagan A, et al. Identification of class II major histocompatibility complex and T cell receptor binding sites in the superantigen toxic shock syndrome toxin 1. J Exp Med 1995; 181:222935.

15. 

Friedman SM, Crow MK, Tumang JR, et al. Characterization of human T cells reactive with the Mycoplasma arthritidisderived superantigen (MAM): generation of a monoclonal antibody against V17, the T cell gene receptor product expressed by a large fraction of MAM-reactive human T cells. J Exp Med 1991; 174:891900.  

16. 

Kappler J, Kotzin B, Herron L, et al. V-specific stimulation of human T cells by staphylococcal toxins. Science 1989; 244:8113.

17. 

Hodtsev AS, Choi Y, Spanopoulou E, Posnett DN. Mycoplasma superantigen: a new type of ligand for the T cell antigen receptor. J Exp Med 1998; 187:31927.

18. 

Novick RP, Muir TW. Virulence gene regulation by peptides in staphylococci and other gram-positive bacteria. Curr Opin Microbiol 1999; 2:405.

19. 

Kuroda M, Ohta T, Uchiyama I, et al. Whole genome sequencing of methicillin-resistant Staphylococcus aureus. Lancet 2001; 357:122540.

20. 

Jones TO, Wieneke AA. Staphylococcal toxic shock syndrome. Vet Rec 1986; 119:4356.

21. 

Matsunaga T, Kamata S, Kakiichi N, Uchida K. Characteristics of Staphylococcus aureus isolated from peracute, acute and chronic bovine mastitis. J Vet Med Sci 1993; 55:297300.

22. 

Lee SU, Quesnell M, Fox LK, et al. Characterization of staphylococcal bovine mastitis isolates using the polymerase chain reaction. J Food Prot 1998; 61:13846.

23. 

Kenny K, Reiser RF, Bastida-Corcuera FD, Norcross NL. Production of enterotoxins and toxic shock syndrome toxin by bovine mammary isolates of Staphylococcus aureus. J Clin Microbiol 1993; 31:7067.

24. 

Projan SJ, Novick RP. The molecular basis of pathogenicity. In: Crossley KB, Archer GL, eds. The staphylococci in human disease. New York: Churchill Livingstone, 1997:5571.

25. 

Schlievert PM, Osterholm MT, Kelly JA, Nishimura RD. Toxin and enzyme characterization of Staphylococcus aureus isolates from patients with and without toxic shock syndrome. Ann Intern Med 1982; 96:93740.

26. 

Vojtov N, Ross HF, Novick RP. Global repression of exotoxin synthesis by staphylococcal superantigens. Proc Natl Acad Sci USA 2002; 99:101027. 

27. 

Kent TH. Staphylococcal enterotoxin gastroenteritis in rhesus monkeys. Am J Pathol 1966; 48:387407. 

28. 

Hamad ARA, Marrack P, Kappler JW. Transcytosis of staphylococcal superantigen toxins. J Exp Med 1997; 185:144754.

29. 

Linnemann CC, Staneck JL, Hornstein S, et al. The epidemiology of genital colonization with Staphylococcus aureus. Ann Intern Med 1982; 96:9404.