点击显示 收起
Department of Pediatrics, University of Texas Health Science CenterHouston, Houston
Background.
Respiratory syncytial virus (RSV) infection of respiratory epithelial cell cultures increases expression of inducible nitric oxide synthase (iNOS). The present study was designed to evaluate both the effect of RSV infection on expression of iNOS and the role of NO in the host responses to RSV infection in vivo.
Methods.
RSV infection was performed by nasal inoculation of BALB/c mice (68 weeks old). Total cell and differential counts were measured in bronchoalveolar lavage (BAL) fluid. Lung nitrates were measured in BAL fluid by use of the Greiss reaction, and cytokines were measured by enzyme-linked immunosorbent assay. Lung hyperresponsiveness to methacholine was measured by use of a Buxco unrestrained whole-body plethysmograph.
Results.
RSV infection increased levels of lung nitrites, levels of iNOS protein and activity, and levels of iNOS mRNA. RSV infection resulted in recruitment of neutrophils and lymphocytes into the lungs, enhanced levels of interferon (IFN)-, and increased airway hyperresponsiveness (AHR). Treatment with iNOS inhibitors (2-amino-5,6-dihydro-6-mehyl-4H-1,3-thiazine and N-nitro-L-arginine methyl ester) increased RSV titers in the lungs yet reduced lung inflammation and RSV-induced AHR. Inhibition of iNOS activity with either agent did not significantly alter levels of IFN- or interleukin-4 in the lungs.
Conclusions.
The results of the present study suggest that RSV-induced production of NO participates in complex host responses and may mediate important aspects of the clinical disease.
Respiratory syncytial virus (RSV) is the most common cause of bronchiolitis and other lower respiratory infections in infants and young children. More than one-half of infants are infected during the first year of life, resulting in countless visits to the physician and emergency room, >100,000 hospitalizations, and, occasionally, death (primarily in high-risk infants) [1, 2]. In addition to causing acute respiratory illnesses characterized by lower airway obstruction, RSV infection during infancy has been associated with development of recurrent wheezing and asthma [3, 4]. Studies performed in animal models [57] and clinical investigations of either children with RSV bronchiolitis [8, 9] or adult volunteers [10] have demonstrated a central role for inflammation in the clinical symptoms associated with RSV lower respiratory disease.
To determine the mechanisms of RSV-induced inflammation, cell-culture models have been developed, focusing on the respiratory epithelium (cell lines and primary respiratory epithelial cell cultures) as the natural "target" for acute RSV infection. RSV infection of respiratory epithelial cells has been demonstrated to induce expression of several proinflammatory proteins, including cytokines and chemokines (tumor necrosis factor , interleukin [IL]1, IL-1, IL-6, IL-8, RANTES, and macrophage inflammatory protein 1 [1113]), receptor proteins (intercellular adhesion molecule 1 and Fas [14, 15]), and other important cell-signaling molecules, including NO [16]. The control of expression of these molecules is regulated at the transcriptional level by a number of transcription factors, which are activated after RSV infection [1214].
Recent evidence suggests that NO is a key mediator of inflammation in the airway, potentially facilitating the complex interaction of multiple resident cell types and migrating inflammatory cells into the airway [17]. Its formation is catalyzed by NO synthase (NOS), which exists in 3 distinct isoforms that have characteristic patterns of tissue-specific expressionconstitutively expressed neural NOS (nNOS), endothelial NOS (eNOS), and inducible NOS (iNOS) [17]. Expression of iNOS (MW, 131,000 [18]) in macrophages, neutrophils, endothelial and smooth muscle cells, and the respiratory epithelium has been described and is transcriptionally regulated by a number of proinflammatory cytokinesincluding TNF-, interferon (IFN), and IL-1at least partially through activation of NF-B [19, 20]. In allergic inflammation models, NO may predispose the development of CD4 T lymphocytes toward a Th2 phenotype and inhibit formation of Th1 [17, 21]. The effects of NO on viral replication and viral clearance have been studied in several animal models, with variable effects, depending on the virus and the system studied [17, 2226]. However, results of mouse respiratory infection models clearly demonstrate the contribution of NO to the development of acute lung inflammation and mouse mortality during viral infection [17, 2127]. Therefore, NO may play a pivotal role in the development of acute lung inflammation and injury and in the establishment of the Th1- or Th2-like phenotypes seen in RSV-infected infants.
To extend our previous studies of the effects of NO during RSV infection in cell culture [16], we have investigated the effects of RSV infection on production of NO and expression of iNOS in the BALB/c mouse model. Furthermore, we sought to better understand the functional role played by RSV, by producing pharmacologic inhibition of production of NO. Production of NO, NOS activity, and expression of iNOS mRNA were significantly increased in RSV-infected mice, and immunohistochemical analysis clearly identified iNOS in the respiratory epithelium as the major NOS enzyme altered during acute RSV infection. Prevention of formation of NO significantly impaired the ability of mice to clear RSV from the lungs. Of interest, inhibition of production of NO was associated with decreased recruitment of inflammatory cells into the lungs and reduced airway hyperresponsiveness (AHR) to methacholine. These data imply that NO plays a role in mediating the acute clinical findings in children with RSV bronchiolitis, including immune and functional responses. Therefore, production of NO may be an important early step in a cascade of events that results in the clinical disease caused by RSV.
MATERIALS AND METHODS
Virus and reagents.
Human RSV (strain A2) used in the present study was obtained from the American Type Culture Collection. Mouse monoclonal antibodies directed against iNOS, nNOS, and eNOS were obtained from Santa Cruz Biotechnology and Transduction Laboratories. The reagents for gel electrophoresis were obtained from Bio-Rad Laboratories, Life Science Group. The enhanced chemiluminescence (ECL) detection system and photographic film were obtained from Amersham Life Science. IL-4 and IFN- were assayed by use of kits obtained from R&D Systems. All media and test reagents were obtained from Sigma Chemical, unless otherwise indicated.
Experimental animals, RSV infection, and treatment with NOS inhibitors.
Female BALB/c mice obtained from Harlan Sprague Dawley were used in all experiments. After being sedated with ketamine and xylazine, mice were infected by intranasal inoculation with 5 × 105 pfu of RSV A2. This experimental protocol has been described elsewhere [6, 16]. RSV infection was confirmed by measuring titers in the lungs. All procedures used in the present study were approved by the Animal Welfare Committee at the University of Texas Health Science CenterHouston and are compliant with federal guidelines. To evaluate the effects of inhibition of NOS activity in our in vivo model, RSV infection was performed in the absence or presence of AMT (2-amino-5,6-dihydro-6-mehyl-4H-1,3-thiazine; Sigma Chemical) or L-NAME (N-nitro-L-arginine methyl ester; Sigma Chemical), a specific inhibitor of iNOS and a nonspecific inhibitor of NOS isoforms, respectively [28]. These agents were given intraperitoneally (ip) daily for 4 days, beginning 1 h before RSV infection, at the following doses: 4 mg/kg for AMT and 100 mg/kg for L-NAME. As shown by other investigators [28] and by our preliminary studies (data not shown), this experimental protocol resulted in inhibition of production of NO in our mouse system. Control mice received normal saline ip in a similar manner and schedule. On the basis of preliminary dose-response and time-response studies, the experiments using NOS inhibitors were performed on day 4 after RSV infection, at the peak of viral replication.
Measurement of NOS activity, immunolabeling of NOS isoforms, and real-time quantitative reverse-transcriptase polymerase chain reaction (RT-PCR) analysis of iNOS mRNA.
NOS activity was detected by use of commercially available kits (Calbiochem-Novabiochem). NOS protein was detected in mouse lung sections by use of a Vectastain Elite ABC Kit (Vector Lab) and commercially available NOS antibodies, as described elsewhere [16]. Similarly, nitrite was measured in bronchoalveolar lavage (BAL) fluids by use of the Griess reaction, as described elsewhere [16].
Real-time quantitative RT-PCR was performed to accurately measure levels of iNOS mRNA in the lungs of control and RSV-infected mice [29, 30]. Assays were performed by the Quantitative Genomics Core Laboratory (QGCL), a fee-for-use facility at the University of Texas Health Science CenterHouston. Specific quantitative assays for measurement of iNOS were developed by use of Primer Express software (version 2.0; Applied Biosystems), in accordance with the recommended guidelines, on the basis of sequences from GenBank. The forward and reverse primers and the fluorogenic probe for iNOS (GenBank accession no. M84373) were (2176+)CAGCTGGGCTGTACAAACCTT, (2241-)ATGTGATGTTTGCTTCGGACA, and (2198+)FAM-CGGGCAGCCTGTGAGACCTTTG-TAMRA, respectively. Total RNA was prepared for analysis (as required by the QGCL), analysis was performed by use of the 7700 Sequence Detector (ABI 7700; Applied Biosystems) [29, 30], and the resulting data were analyzed by use of SDS software (version 1.9.1; Applied Biosystems). The amount of RNA added to an RT-PCR, from each sample of RNA isolated from lung homogenates, was determined by measuring the level of a housekeeping transcript in each sample. The final data were normalized to -actin, 36B4, and expressed as molecules of transcript/molecules of normalizer transcript × 100(percentage of normalizer transcript). The forward and reverse primers and the fluorogenic probe for -actin (GenBank accession no. NM_007393) were (1037+)TCTGGCTCCTAGCACCATGA, (1108#2-)CCACCGATCCACACAGAGTACT, and (1059+)FAM-ATCAAGATCATTGCTCCTCCTGAGCGC-BHQ1, respectively.
BAL fluid studies.
After studies of airway mechanics, the mice underwent BAL with 4 aliquots of 0.5 mL of PBS, with 90% recovery. Total cell counts (cells per milliliter) were determined by use of a Brite-Line hemocytometer (Hausser Scientific). Cell differential counts were calculated after cells had been prepared by cytocentrifugation (Cytospin 4; Shandon) and stained with modified Wrights stain and were expressed as the percentage of total BAL fluid cells. Cytokine concentrations were measured in duplicate by ELISA (R&D Systems) and expressed in terms of picograms per milliliter (mean ± SE). The limits of detection for IFN- and IL-4 were 8 and 4 pg/mL, respectively.
Measurement of respiratory system mechanics.
AHR was measured in unrestrained mice by barometric plethysmography, by use of a whole-body plethysmograph (Buxco), as described elsewhere [3133]. AHR was expressed as an enhanced minute pause (Penh), a calculated value that reflects pulmonary resistance, measured by use of a conventional 2-chamber plethysmograph in ventilated animals [34]. This value was derived from bronchoconstriction-induced changes in box pressure during expiration (PEP) and changes in box pressure during inspiration (PIP). Penh values were calculated according to the formula Penh - pause × PEP/PIP, where "pause" reflects the timing of expiration. Mice were exposed to nebulized physiologic saline for 3 min and then to increasing concentrations of nebulized methacholine (350 mg/mL), by use of an ultrasonic nebulizer. Measurements were obtained for 3 min after the completion of each nebulization. Penh values measured during this period were averaged and expressed as absolute Penh values.
Statistical analysis.
All results are expressed as mean ± SE, and n is the number of mice. Student's unpaired t test and 1- or 2-way analysis of variance methods were used to determine the level of difference, when appropriate. When a statistically significant difference was present, Bonferroni adjustments were performed. P < .05 was considered to be significant.
RESULTS
NOS activity and enzyme localization.
Levels of nitrites in BAL fluid increased in RSV-infected mice, compared with those in control mice (figure 1A). The level of nitrites remained increased through day 14 after RSV infection. In addition, increased NOS enzymatic activity could be readily detected in lung homogenates 4 days after RSV infection (figure 1B).
To determine which of the NOS isoforms was increased after RSV infection and the cell source of the NOS increase, immunohistochemical analysis was performed in control and RSV-infected BALB/c mice (days 4 and 7 after RSV infection). No significant differences in nNOS or eNOS activity or localization were observed between the control and RSV-infected mice (figure 2A). However, increases in iNOS activity were observed after RSV infection, with the respiratory epithelium of the large airways being the primary location of the increase (figure 2A). Western-blot analysis of lung homogenates clearly demonstrated increased levels of iNOS protein on days 4 and 7 after RSV infection (figure 2B). Levels of iNOS mRNA were significantly increased in lung homogenates on day 4, but not on day 7 or 14, after RSV infection (figure 3).
Role of iNOS in clearance of RSV and inflammatory cells.
To determine the role of iNOS in clearance of RSV, mice were treated with AMT or L-NAME, and titers in the lungs were measured on day 4 after RSV infection (the usual day of peak titers). Inhibition of iNOS and total NOS activity resulted in a 61.0% and 84.2% increase of viral titers, respectively (figure 4), indicating that iNOS plays an important role in clearance of RSV from the lungs. Treatment with AMT or L-NAME effectively reduced RSV-induced production of NO to control levels (data not shown).
In parallel with the decrease in clearance of RSV after inhibition of NOS activity, there was a marked decrease in the recruitment of inflammatory cells into the lungs in RSV-infected BALB/c mice after treatment with L-NAME. Numbers of macrophages, lymphocytes, and neutrophils were all decreased in the BAL fluid from RSV-infected L-NAMEtreated mice, compared with those in untreated mice (figure 5A). However, treatment with L-NAME did not reduce cell counts to control levels (figure 5A). The percentage of macrophages (relative percentage of BAL macrophage count/total cell count) was reduced after RSV infection, regardless of whether treatment with L-NAME was given, because of the proportionally greater numbers of lymphocytes and neutrophils recruited into the airway (figure 5B). The percentage of lymphocytes and the percentage of neutrophils were increased, compared with those in control mice, and there was no difference between them after treatment with L-NAME. Therefore, the biggest effect of RSV infection on airway inflammation was the recruitment of cells into the airway, and the biggest effect of inhibition of NO was the reduction of recruitment of inflammatory cells, not the type of cells coming into the airway.
RSV infection increased levels of IFN- (Th1) and modestly decreased levels of IL-4 (Th2), compared with those in control mice (figure 6). Pretreatment of mice with L-NAME did not alter these changes in RSV-infected mice (figure 6).
Effect of NOS inhibitors on AHR after RSV infection.
RSV infection significantly increased AHR to methacholine, compared with that in control mice (figure 6). However, treatment of mice with either L-NAME or AMT decreased AHR to methacholine, as demonstrated by a rightward shift of the dose-response curve to methacholine and by lower Penh values at 50 mg/mL (figure 7). In selected experiments in control mice, AMT and L-NAME did not alter baseline Penh values or airway responses to increasing concentrations of methacholine (data not shown).
DISCUSSION
There is an ongoing debate regarding the role of NO in acute lung injurydoes it ameliorate or contribute to the injury and resulting clinical illness NO has been shown to play both beneficial and deleterious roles in several lung diseases, including asthma, chronic obstructive pulmonary disease, cystic fibrosis, and acute lung injury [27, 35, 36]. For example, in iNOS knockout mice, after exposure to endotoxins, there is a decreased accumulation of neutrophils and production of cytokines, compared with that in control mice [27]. In the present study, we have demonstrated that RSV infection in BALB/c mice increased production of NO in the lungs (measured as nitrite and suggested by increased NOS activity). Immunohistochemical and Western-blot analyses demonstrated that iNOS was the NOS isoform that was primarily increased after RSV infection and that the major location of this increase was the respiratory epithelium cells. Expression of iNOS mRNA was highest on day 4 after RSV infection, whereas NOS activity and levels of iNOS protein remained increased through day 7 after RSV infection, and levels of nitrites remained increased through day 14 after RSV infection. Inhibition of NOS activity by L-NAME and AMT decreased clearance of RSV from the lungs yet also decreased the recruitment of inflammatory cells into the BAL fluid. Of interest, inhibition of NOS activity appears to protect against the AHR induced by RSV infection. Therefore, NO activity in the lungs appears to be a 2-edged sword: production of NO and NOS activity enhance clearance of RSV, yet they contribute to both airway inflammatory changes and airway dysfunction.
A number of respiratory viruses have been found to induce production of NO by respiratory epithelium, both in vitro and in vivo, including influenza virus [22, 23, 26], adenovirus [37], rhinovirus [38], Sendai virus [26], and RSV [16]. Moreover, production of NO in vivo has been demonstrated to significantly contribute to clearance of some viruses [3943]. The present study has demonstrated a clear role for production of NO in the clearance of RSV in adult BALB/c mice: both AMT and L-NAME had similar effects in decreasing clearance of RSV. iNOS-deficient mice have been reported to use a non-NO interferon-dependent pathway to clear influenza A from the lungs [22, 26]. Despite the decrease in clearance of RSV demonstrated after inhibition of iNOS, the mice did not die of RSV infection, nor did they appear to be clinically "sicker" than the control mice (data not shown), implying that the viral replication itself was not responsible for the clinical illness in these mice.
The presence of acute lung injury and acute respiratory failure in some infants with bronchiolitis has led to clinical trials using NO in ventilated patients [44, 45]. The effects of therapy with NO on the actual viral titers have not been reported for these patients. However, limitation of viral replication by NO, as a single clinical effect, would not be anticipated to be of great benefit in altering the course of RSV bronchiolitis. The antiviral agent ribavirin has been demonstrated to limit RSV replication in children with bronchiolitis yet has limited clinical efficacy in treating otherwise healthy children with RSV lower respiratory disease [46]. Studies performed in animal models [57] and clinical investigations of either children with RSV bronchiolitis [8, 9, 47] or adult volunteers [10] have demonstrated a central role for inflammation in the clinical symptoms associated with RSV lower respiratory disease. Studies of mice have demonstrated that suppression of iNOS activity significantly reduces lung inflammation and pneumonia after viral exposure [22, 24, 26]. However, the role that NO plays in airway inflammation has proven to be complex, and other investigators have demonstrated that NO may be antiinflammtory or proinflammatory depending on the source and context of the airway injury studied [4851]. Studies in cell-culture models indicate that NO inhibits production of cytokines [28, 41], implying that inhibition of NO decreases lung inflammation by other mechanisms, such as decreasing interactions with reactive oxygen species to produce peroxynitrite and 8-nitroguanosine [25, 26, 37]. RSV infection of respiratory epithelial cells has been demonstrated to induce expression of several proinflammatory proteins, including cytokines and chemokines (TNF-, IL-1, IL-1, IL-6, IL-8, RANTES, and MIP-1 [1113]), receptor proteins (ICAM-1 and FAS [14, 15]), and other important cell-signaling molecules, including NO [16]. The control of expression of these molecules is regulated at the transcriptional level by a number of transcription factors [12, 14], and the cellular mechanisms resulting in the activation of these factors have been the subject of considerable investigation [5254]. The activation of these transcription factors controls the early activation steps in the inflammatory cascade and would likely be key targets to prevent virus-induced lung inflammation. For the reasons discussed above, the clinical efficacy of therapy with exogenous NO (as an antiviral or antiflammatory agent) in children with RSV bronchiolitis is hard to predict and requires further investigations in animal models and in patients with RSV lower respiratory disease.
The complex intercellular relationships and interactions inferred from data derived from cell-culture models and human studies remain difficult to define. These studies have demonstrated that RSV infection can initiate a complex cascade of events and mediators, thus leading to long-term alterations in the immune system, involving multiple cell types and T cell subsets [55, 56]. The net effect is the establishment of a propensity toward a Th2-like lymphocyte phenotype (associated with atopy and asthma) [7, 55, 57, 58] or a Th1-like lymphocyte phenotype (associated with viral clearance). Moreover, cytotoxic T cells (both CD8 and CD4 Th1) and CD4 Th2 play roles in viral clearance through production of IFN- [23, 59, 60] and IL-12 [61] yet may contribute to lung disease associated with RSV infection [7, 57, 62]. The data presented here demonstrate that RSV induces expression of IFN- without much effect on production of IL-4. This induction of production of IFN- by RSV infection is not significantly altered by treatment with L-NAME, suggesting that other activation pathways lead to its production.
The role of iNOS in AHR is somewhat controversial, with effects in some models but not in others [17, 35, 63]. In the BALB/c mouse model presented here, RSV infection significantly increased AHR to methacholine, compared with that in control mice. Inhibition of NOS activity by AMT or L-NAME reduced this RSV-induced AHR. The mechanisms by which NO is involved in the modulation of airway function are not known and will need further study. Although NO is considered to be a relaxant of the airway smooth muscle and a mediator of the nonadrenergic noncholinergic inhibitory system in human airways, these effects have not been seen in the mouse airway (G. L. Larsen and G.N.C., unpublished data). Potential explanations for the response observed after inhibition of NOS activity could include a decrease in airway responsiveness mediated by the reduction in inflammatory cells and, possibly, IFN-.
In summary, RSV infection results in increased production of NO as well as increased expression of iNOS protein and mRNA. The increased production of NO after RSV infection results primarily from the induction of epithelial cellassociated iNOS. NO contributes to clearance of RSV and is also involved in the recruitment of inflammatory cells, production of IFN-, and AHR. Further studies of the mechanisms of activation of NOS and production of NO will be necessary to develop therapies to modulate the effects of NO after RSV infection, potentially altering the resulting respiratory disease. Whether such modulation of NO will significantly alter the course of RSV bronchiolitis in children remains unclear, but intervention during the early events causing inflammation and AHR could potentially ameliorate the resulting lung disease in children.
Acknowledgments
We thank Yachu J. Kao and Theran McCormick, for technical support in the study design, immunohistochemical analysis, and Western-blot studies described above. In addition, we acknowledge the support of the Quantitative Genomics Core Laboratory at The University of Texas Health Science CenterHouston, for the studies involving quantitative real-time reverse-transcriptase polymerase chain reactions.
References
1. Shay DK, Holman RC, Newman RD, Liu LL, Stout JW, Anderson LJ. Bronchiolitis-associated hospitalizations among US children, 19801996. JAMA 1999; 282:14406. First citation in article
2. Holman RC, Shay DK, Curns AT, Lingappa JR, Anderson LJ. Risk factors for bronchiolitis-associated deaths among infants in the United States. Pediatr Infect Dis J 2003; 22:48390. First citation in article
3. Lemanske RF Jr. The childhood origins of asthma (COAST) study. Pediatr Allergy Immunol 2002; 13(Suppl 15):3843. First citation in article
4. Taussig LM, Wright AL, Holberg CJ, Halonen M, Morgan WJ, Martinez FD. Tucson Children's Respiratory Study: 1980 to present. J Allergy Clin Immunol 2003; 111:66175. First citation in article
5. Prince GA, Jenson AB, Horswood RL, Camargo E, Chanock RM. The pathogenesis of respiratory syncytial virus infection in cotton rats. Am J Pathol 1978; 93:77191. First citation in article
6. Graham BS, Perkins MD, Wright PF, Karzon DT. Primary respiratory syncytial virus infection in mice. J Med Virol 1988; 26:15362. First citation in article
7. Openshaw PJ. Immunity and immunopathology to respiratory syncytial virus: the mouse model. Am J Respir Crit Care Med 1995; 152:S5962. First citation in article
8. Aherne W, Bird T, Court SD, Gardner PS, McQuillin J. Pathological changes in virus infections of the lower respiratory tract in children. J Clin Pathol 1970; 23:718. First citation in article
9. Everard ML, Swarbrick A, Wrightham M, et al. Analysis of cells obtained by bronchial lavage of infants with respiratory syncytial virus infection. Arch Dis Child 1994; 71:42832. First citation in article
10. Noah TL, Becker S. Chemokines in nasal secretions of normal adults experimentally infected with respiratory syncytial virus. Clin Immunol 2000; 97:439. First citation in article
11. Noah TL, Becker S. Respiratory syncytial virusinduced cytokine production by a human bronchial epithelial cell line. Am J Physiol 1993; 265:L4728. First citation in article
12. Mastronarde JG, Monick MM, Hunninghake GW. Oxidant tone regulates IL-8 production in epithelium infected with respiratory syncytial virus. Am J Respir Cell Mol Biol 1995; 13:23744. First citation in article
13. Stark JM. The induction of chemokines by viruses in allergic states. In: Rothenberg ME, ed. Chemokines in allergic disease. New York: Marcel Dekker, 2000:26387. First citation in article
14. Chini BA, Fiedler MA, Milligan L, Hopkins T, Stark JM. Essential roles of NF-B and C/EBP in the regulation of intercellular adhesion molecule1 after respiratory syncytial virus infection of human respiratory epithelial cell cultures. J Virol 1998; 72:16236. First citation in article
15. O'Donnell DR, Milligan L, Stark JM. Induction of CD95 (Fas) and apoptosis in respiratory epithelial cell cultures following respiratory syncytial virus infection. Virology 1999; 257:198207. First citation in article
16. Kao YJ, Piedra PA, Larsen GL, Colasurdo GN. Induction and regulation of nitric oxide synthase in airway epithelial cells by respiratory syncytial virus. Am J Respir Crit Care Med 2001; 163:5329. First citation in article
17. Ricciardolo FL. Multiple roles of nitric oxide in the airways. Thorax 2003; 58:17582. First citation in article
18. Geller DA, Billiar TR. Molecular biology of nitric oxide synthases. Cancer Metastasis Rev 1998; 17:723. First citation in article
19. Nathan C. Nitric oxide as a secretory product of mammalian cells. FASEB J 1992; 6:305164. First citation in article
20. Xie Q, Nathan C. The high-output nitric oxide pathway: role and regulation. J Leukoc Biol 1994; 56:57682. First citation in article
21. Xiong Y, Karupiah G, Hogan SP, Foster PS, Ramsay AJ. Inhibition of allergic airway inflammation in mice lacking nitric oxide synthase 2. J Immunol 1999; 162:44552. First citation in article
22. Akaike T, Noguchi Y, Ijiri S, et al. Pathogenesis of influenza virusinduced pneumonia: involvement of both nitric oxide and oxygen radicals. Proc Natl Acad Sci USA 1996; 93:244853. First citation in article
23. Karupiah G, Chen JH, Mahalingam S, Nathan CF, MacMicking JD. Rapid interferon dependent clearance of influenza A virus and protection from consolidating pneumonitis in nitric oxide synthase 2deficient mice. J Exp Med 1998; 188:15416. First citation in article
24. Domachowske JB, Bonville CA, Ali-Ahmad D, Dyer KD, Easton AJ, Rosenberg HF. Glucocorticoid administration accelerates mortality of pneumovirus-infected mice. J Infect Dis 2001; 184:151823. First citation in article
25. Suliman HB, Ryan LK, Bishop L, Folz RJ. Prevention of influenza-induced lung injury in mice overexpressing extracellular superoxide dismutase. Am J Physiol Lung Cell Mol Physiol 2001; 280:L6978. First citation in article
26. Akaike T, Okamoto S, Sawa T, et al. 8-nitroguanosine formation in viral pneumonia and its implication for pathogenesis. Proc Natl Acad Sci USA 2003; 100:68590. First citation in article
27. Shanley TP, Zhao B, Macariola DR, Denenberg A, Salzman AL, Ward PA. Role of nitric oxide in acute lung inflammation: lessons learned from the inducible nitric oxide synthase knockout mouse. Crit Care Med 2002; 30:19608. First citation in article
28. Trifilieff A, Fujitani Y, Mentz F, Dugas B, Fuentes M, Bertrand C. Inducible nitric oxide synthase inhibitors suppress airway inflammation in mice through down-regulation of chemokine expression. J Immunol 2000; 165:152633. First citation in article
29. Gibson UE, Heid CA, Williams PM. A novel method for real time quantitative RT-PCR. Genome Res 1996; 6:9951001. First citation in article
30. Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative PCR. Genome Res 1996; 6:98694. First citation in article
31. Chunn JL, Young HW, Banerjee SK, Colasurdo GN, Blackburn MR. Adenosine-dependent airway inflammation and hyperresponsiveness in partially adenosine deaminasedeficient mice. J Immunol 2001; 167:467685. First citation in article
32. Cochran JR, Khan AM, Elidemir O, et al. Influence of lipopolysaccharide exposure on airway function and allergic responses in developing mice. Pediatr Pulmonol 2002; 34:26777. First citation in article
33. Khan AM, Lally KP, Elidemir O, Colasurdo GN. Meconium enhances the release of nitric oxide in human airway epithelial cells. Biol Neonate 2002; 81:99104. First citation in article
34. Hamelmann E, Schwarze J, Takeda K, et al. Noninvasive measurement of airway responsiveness in allergic mice using barometric plethysmography. Am J Respir Crit Care Med 1997; 156:76675. First citation in article
35. Eynott PR, Groneberg DA, Caramori G, et al. Role of nitric oxide in allergic inflammation and bronchial hyperresponsiveness. Eur J Pharmacol 2002; 452:12333. First citation in article
36. Nevin BJ, Broadley KJ. Nitric oxide in respiratory diseases. Pharmacol Ther 2002; 95:25993. First citation in article
37. Zsengeller ZK, Ross GF, Trapnell BC, Szabo C, Whitsett JA. Adenovirus infection increases iNOS and peroxynitrite production in the lung. Am J Physiol Lung Cell Mol Physiol 2001; 280:L50311. First citation in article
38. Sanders SP, Siekierski ES, Richards SM, Porter JD, Imani F, Proud D. Rhinovirus infection induces expression of type 2 nitric oxide synthase in human respiratory epithelial cells in vitro and in vivo. J Allergy Clin Immunol 2001; 107:23543. First citation in article
39. Croen KD. Evidence for antiviral effect of nitric oxide: inhibition of herpes simplex virus type 1 replication. J Clin Invest 1993; 91:244652. First citation in article
40. Adler H, Beland JL, Del Pan NC, et al. Suppression of herpes simplex virus type 1 (HSV-1)induced pneumonia in mice by inhibition of inducible nitric oxide synthase (iNOS, NOS2). J Exp Med 1997; 185:153340. First citation in article
41. Sanders SP, Siekierski ES, Porter JD, Richards SM, Proud D. Nitric oxide inhibits rhinovirus-induced cytokine production and viral replication in a human respiratory epithelial cell line. J Virol 1998; 72:93442. First citation in article
42. Gao X, Tajima M, Sairenji T. Nitric oxide down-regulates Epstein-Barr virus reactivation in epithelial cell lines. Virology 1999; 258:37581. First citation in article
43. Saura M, Zaragoza C, McMillan A, et al. An antiviral mechanism of nitric oxide: inhibition of a viral protease. Immunity 1999; 10:218. First citation in article
44. Hoehn T, Krause M, Krueger M, Hentschel R. Treatment of respiratory failure with inhaled nitric oxide and high-frequency ventilation in an infant with respiratory syncytial virus pneumonia and bronchopulmonary dysplasia. Respiration 1998; 65:47780. First citation in article
45. Leclerc F, Scalfaro P, Noizet O, Thumerelle C, Dorkenoo A, Fourier C. Mechanical ventilatory support in infants with respiratory syncytial virus infection. Pediatr Crit Care Med 2001; 2:197204. First citation in article
46. van Woensel J, Kimpen J. Therapy for respiratory tract infections caused by respiratory syncytial virus. Eur J Pediatr 2000; 159:3918. First citation in article
47. Noah TL, Henderson FW, Wortman IA, et al. Nasal cytokine production in viral acute upper respiratory infection of childhood. J Infect Dis 1995; 171:58492. First citation in article
48. Hongo D, Bryson JS, Kaplan AM, Cohen DA. Endogenous nitric oxide protects against T celldependent lethality during graft-versus-host disease and idiopathic pneumonia syndrome. J Immunol 2004; 173:174456. First citation in article
49. Okamoto T, Gohil K, Finkelstein EI, Bove P, Akaike T, van der Vliet A. Multiple contributing roles for NOS2 in LPS-induced acute airway inflammation in mice. Am J Physiol Lung Cell Mol Physiol 2004; 286:L198209. First citation in article
50. Speyer CL, Neff TA, Warner RL, et al. Regulatory effects of iNOS on acute lung inflammatory responses in mice. Am J Pathol 2003; 163:231928. First citation in article
51. Zeidler PC, Millecchia LM, Castranova V. Role of inducible nitric oxide synthasederived nitric oxide in lipopolysaccharide plus interferon-induced pulmonary inflammation. Toxicol Appl Pharmacol 2004; 195:4554. First citation in article
52. Haeberle HA, Takizawa R, Casola A, et al. Respiratory syncytial virusinduced activation of nuclear factorB in the lung involves alveolar macrophages and Toll-like receptor 4dependent pathways. J Infect Dis 2002; 186:1199206. First citation in article
53. Haeberle HA, Nesti F, Dieterich HJ, Gatalica Z, Garofalo RP. Perflubron reduces lung inflammation in respiratory syncytial virus infection by inhibiting chemokine expression and nuclear factorB activation. Am J Respir Crit Care Med 2002; 165:14338. First citation in article
54. Haeberle HA, Casola A, Gatalica Z, et al. IB kinase is a critical regulator of chemokine expression and lung inflammation in respiratory syncytial virus infection. J Virol 2004; 78:223241. First citation in article
55. Graham BS, Bunton LA, Wright PF, Karzon DT. Role of T lymphocyte subsets in the pathogenesis of primary infection and rechallenge with respiratory syncytial virus in mice. J Clin Invest 1991; 88:102633. First citation in article
56. Openshaw PJ. RSV bronchiolitis, T cells and asthma: are they linked Clin Exp Immunol 2003; 131:1978. First citation in article
57. Alwan WH, Record FM, Openshaw PJM. CD4+ T cells clear virus but augment disease in mice infected with respiratory syncytial viruscomparison with the effects of CD8+ T cells. Clin Exp Immunol 1992; 88:52736. First citation in article
58. Hussell T, Baldwin CJ, O'Garra A, Openshaw PJ. CD8+ T cells control Th2-driven pathology during pulmonary respiratory syncytial virus infection. Eur J Immunol 1997; 27:33419. First citation in article
59. Durbin JE, Johnson TR, Durbin RK, et al. The role of IFN in respiratory syncytial virus pathogenesis. J Immunol 2002; 168:294452. First citation in article
60. van Schaik SM, Obot N, Enhorning G, et al. Role of interferon gamma in the pathogenesis of primary respiratory syncytial virus infection in BALB/c mice. J Med Virol 2000; 62:25766. First citation in article
61. Diefenbach A, Schindler H, Rollinghoff M, Yokoyama WM, Bogdan C. Requirement for type 2 NO synthase for IL-12 signaling in innate immunity. Science 1999; 284:9515. First citation in article
62. Cannon MJ, Openshaw PJ, Askonas BA. Cytotoxic T cells clear virus but augment lung pathology in mice infected with respiratory syncytial virus. J Exp Med 1988; 168:11638. First citation in article
63. De Sanctis GT, MacLean JA, Hamada K, et al. Contribution of nitric oxide synthases 1, 2, and 3 to airway hyperresponsiveness and inflammation in a murine model of asthma. J Exp Med 1999; 189:162130. First citation in article