点击显示 收起
Department of Emergency Medicine and Division of Molecular and Vascular Medicine, Beth Israel Deaconess Medical Center
Center for Experimental Therapeutics and Reperfusion Injury and Channing Laboratory, Brigham and Women's Hospital, Boston, Massachusetts
CpG oligodeoxynucleotides (ODNs) may prevent mortality from infection. We have identified a therapeutic benefit in treating sepsis with phosphorothioate ODN sequences containing the CpG motif. Sepsis was induced in rats by cecal ligation and puncture (CLP), and treatment with CpG ODNs reduced sepsis mortality from 80% to 15% during a 108-h period. Protection from mortality was dose dependent. Bacterial load in peritoneal fluid was reduced in CpG ODNtreated versus non-CpG ODNtreated rats after CLP. Lung injury, as determined by total myeloperoxidase activity, was also reduced in CpG ODNtreated versus non-CpG ODNtreated rats after CLP. Indirect evidence suggests that CpG-induced expression of interleukin (IL)23 as levels of p40but not p35were significantly increased in both plasma and peritoneal lavage fluid in CpG ODNtreated versus non-CpG ODNtreated rats 24 h after CLP. AntiIL-17 antibody inhibited the CpG-mediated prevention of mortality. These data suggest that IL-17 may mediate CpG-inducible host defenses during intraabdominal sepsis.
Sepsis remains a significant cause of mortality, despite active research and available therapeutic agents [1]. Recent evidence suggests that sepsis induces a significant state of immune suppression, as indicated by a reduction in Th1 cell responses and apoptosis of T, B, and dendritic cells (DCs) [2, 3]. Reversal of apoptosis and immune suppression in animal models correlates with improved outcomes from sepsis [4]. On the basis of these observations, positive immunomodulators may represent beneficial therapeutic agents for sepsis. One such immunomodulator is the Toll-like receptor (TLR) 9 ligand, an unmethylated dinucleotide CpG sequence motif (reviewed in [5]). The specific activity of the CpG ligand is determined by both the number of CpG motifs and the flanking nucleotide sequences [6]. CpG DNA is found in nonmammalian species, including viruses, protozoa, and bacteria, and induces a pathogen-associated molecular pattern response initiating host defense [6, 7].
CpG oligodeoxynucleotides (ODNs) were first utilized to treat intracellular pathogens through mechanisms that enhanced adaptive immunity, including DC maturation and up-regulation of major histocompatibility complex (MHC) class II proteins on DCs and macrophages [8]. CpG ODNs may induce proinflammatory cytokine production, including interferon (IFN), interleukin (IL)6, and IL-12 [9]. CpG ODNs are also capable of enhancing innate immune effector-cell responses to extracellular pathogen infection. In both mouse and chicken models, CpG ODN pretreatment of the host reduced mortality and pathogen load after bacterial infection [10]. These studies demonstrated that CpG ODNs up-regulated local innate immune responses, including polymorphonuclear leukocyte (PMNL) and mononuclear cell infiltration and PMNL phagocytic function [10, 11]. The mechanism by which CpG ODNs altered innate immune function was not reported in these studies; however, in mice, CpG ODNs did not affect serum levels of IL-12, IL-18, or IL-10 [11].
The ability of CpG ODNs to affect both innate and adaptive immune function raises the possibility that components of each system may be involved in promoting beneficial outcomes from infection. The cytokine IL-17 may represent one possible means of T cell regulation of innate immune responses. IL-17 is a member of a family of cytokines that is produced primarily by both T cells and PMNLs [1214]. IL-17 receptor activation leads to synergistic expression of proinflammatory cytokines, including IL-1 and IL-6 [15, 16]. IL-17 expression elicits host protection in a mouse model of Klebsiella pneumonia and generates its effects on bacterial clearance early in the course of infection, suggesting an antigen-independent mechanism [17, 18]. In this model, IL-17 expression was induced by IL-23 and not IL-12, on the basis of the ability of p40-deficientbut not p35-deficientmice to generate the IL-17 response [19]. In peritoneal infection models, IL-17 is required for both adhesion and abscess formation [20, 21]. The specific role of IL-17 in the host response to sepsis induced by cecal ligation and puncture (CLP) is unknown.
We sought to determine whether CpG ODNs might function as a protective immunomodulator when administered at the induction of sepsis, by use of a rodent CLP model. We also sought to determine whether CpG ODNs affect expression of IL-12 or IL-23 during CLP sepsis, by direct measurement of p35 and p40. Finally, we attempted to identify evidence linking IL-17 action to the beneficial effects of CpG ODNs during sepsis.
METHODS
ODNs.
Phosphoorothioate ODN sequences containing CpG motifs and control non-CpG ODN sequences were synthesized and purified by Qiagen. ODN sequences were as follows (CpG motifs are underlined): ODN 1826, TCCATGACGTTCCTGACGTT; and ODN 0x, TCCATGAGCTTCCTGAGCTT [22]. ODNs were analyzed for endotoxin contamination (>10 EU/mL) before use with an assay kit (BioWhittaker).
Antibodies.
Polyclonal rabbit anti-mouse antiIL-17 antibody was produced as described by Chung et al. [20].
CLP sepsis model.
Specific pathogen-free, male Long-Evans rats were purchased from Charles River Labs. All procedures were conducted under an Institutional Animal Care and Use Committeeapproved protocol. Anesthesia was induced with isofluorane, and oxygen was provided via a nose-cone mask. A 2-cm vertical midline incision was made in the lower abdomen and carried to the peritoneum by use of blunt dissection, and the cecum was identified. The cecum was ligated below the ileocecal valve by use of 4-0 vicryl sutures. The ligated cecum was punctured through-and-through by use of a 21-gauge needle and was compressed to express a small amount of fecal material, to ensure patency of the puncture sites. The cecum was returned to the abdominal cavity, the peritoneum and abdominal muscles were closed with 5-0 vicryl sutures, and the overlying skin was approximated with surgical staples. Rats received a 5-mL subcutaneous dose of normal saline for fluid resuscitation. Twenty minutes before closure of the skin, rats received a subcutaneous injection of 1.6 mg/kg of buprenorphine for analgesia. After surgery, rats received additional buprenorphine at 12-h intervals.
Bacterial load.
At necropsy, liver and spleen were harvested, and the peritoneal cavity was lavaged with 5 mL of sterile normal saline. Equal wet tissue weights of liver and spleen were homogenized and briefly centrifuged to remove gross particulate matter. Serial log dilutions of peritoneal lavage fluid (PLF) and spleen and liver homogenates were applied to chocolate agar and blood agar plates and were incubated at 37°C for 48 h under anaerobic conditions and for 24 h under aerobic conditions, respectively. Plates were subsequently analyzed by colony counts, expressed as colony-forming units per milligram of wet tissue weight or colony-forming units per volume of PLF.
ELISA.
ELISA analysis of rat IL-12 (p35) and IL-12/23 (p40) (Biosource) was performed according to the manufacturer's specifications. Sample optical densities were read using a microtiter plate spectrophotometer (Spectramax 190; Molecular Devices), and data were analyzed using the Softmax Pro software package (Molecular Devices).
Tissue myeloperoxidase (MPO) activity.
Measurement of tissue MPO activity was performed as described by Vakeva et al. [23]. Briefly, lung tissue was weighed and homogenized in 4 mL of buffer containing 0.25 mol/L sucrose and 0.1 mmol/L EDTA. Samples were centrifuged at 30,000 g at 4°C for 30 min. Pellets were subjected to freeze/thaw and sonication for 3 cycles. Tissue was homogenized in 0.5% hexadecyltrimethyl ammonium bromide in 500 mmol/L potassium phosphate buffer (pH, 6.0) and then was centrifuged at 12,500 g at 4°C for 15 min. Supernatants were collected and reacted with 0.167 mg/mL o-dianisidine dihydrochloride and 0.0005% H2O2 in 50 mmol/L potassium phosphate buffer (pH, 6.0). Changes in absorbance were measured on a microtiter plate spectrophotometer (Spectromax 190; Molecular Devices) at 460 nm for 10 min. The linear slope of the absorbance change was determined for each sample. One unit of MPO activity was defined as the quantity of MPO that hydrolyzed 1 mol/L H2O2/min at 25°C. Final activity amounts were expressed as units per gram of wet tissue weight.
Histologic analysis of lung tissue.
The right upper and middle lobes of the lung were harvested, and lung tissue was fixed in 10% formalin, paraffin embedded, sectioned, and stained with hematoxylin-eosin. Resultant sections were analyzed on a Nikon TE200 microscope, and representative digital photomicrographs were recorded at 20× magnification.
Apoptosis analysis.
Apoptosis was analyzed using an annexin V/propidium iodide (PI) staining kit (R&D Systems). Thymocytes were isolated as described by Guo et al. [24]. Briefly, 106 cells/mL were incubated in the dark with fluorescein-conjugated annexin V for 5 min, followed by addition of PI to a final concentration of 1 g/mL. Cells (a minimum of 20,000 per sample) were analyzed by flow cytometry using a Coulter EPICS XL cytometer (Becton Dickinson) and the CELLQuest software package (Becton Dickinson). Percentages of early apoptotic cells were determined by staining pattern (early apoptosis, annexin V+/PI-; late apoptosis, annexin V+/PI+).
Apoptotic thymocytes were also identified by TUNEL staining of thymus sections. Briefly, thymus tissue was fixed in 4% formalin overnight, embedded in paraffin, and sectioned. End-labeling of DNA fragments in tissue sections with fluorescein isothiocyanatedUTP was performed according to the manufacturer's specifications (Roche). Sections were also counterstained with an smooth-muscle actin-Cy3conjugated antibody (Sigma). TO-PRO-3 was used to counterstain cell nuclei, as directed by the manufacturer (Molecular Probes). Slides were treated with ProlongAntifade Kit (Molecular Probes) and analyzed by confocal microscopy (Bio-Rad).
Statistical analysis.
Statistical analysis was performed using analysis of variance (ANOVA), with the exception of survival analyses, which were performed using a log-rank test. The significance level was set at P < .05. Statistical analyses were performed using the Statview and JMP software packages (Abbacus/SAS Institute).
RESULTS
To determine the dose dependency of CpG ODN mortality protection in sepsis, we induced sepsis in Long-Evans rats by CLP and administered single doses of ODN 1826 in increasing concentrations (0.033, 0.167, and 0.667 mg/kg) by ip injection at the conclusion of CLP surgery. CpG ODN protection from sepsis mortality was dose dependent (figure 2), with maximal protection at a dose of 0.667 mg/kg (P = .005 and .01, for the 0.667 and 0.167 mg/kg groups, respectively, by log-rank test). No signs of toxicity were observed when the 0.667 mg/kg dose was used in sham-operated rats.
Reduction in sepsis-induced lung injury.
Sepsis induces multiple-organ damage at sites distant from the primary infection. To determine whether CpG ODNs had a beneficial effect on organ systems distinct from the peritoneal compartment during sepsis, we chose to evaluate inflammatory changes in lung tissue after CLP. Rats underwent sham surgery or CLP surgery, followed by treatment with 0.667 mg/kg of either ODN 1826 or ODN 0x by ip injection. Twenty-four hours after CLP, lung tissue was harvested and processed for histologic assessment and measurement of MPO activity. CLP induced a 28-fold increase in total lung MPO activity after 24 h, compared with that in sham-operated controls (P = .002; table 1). ODN 1826 treatment reduced total lung MPO activity to control levels; there was no statistical difference in MPO activity between these groups (P = .32). Histologic analysis showed interstitial infiltration, predominantly of mononuclear cells, in lungs from CLP-septic rats treated with ODN 0x, compared with lungs from sham-operated controls (figure 7). Cellular infiltration was reduced in CLP-septic rats treated with ODN 1826, compared with those treated with ODN 0x (figure 7).
DISCUSSION
Prevention of immune suppression may lead to beneficial outcomes during sepsis and may represent a novel therapeutic intervention point. CpG ODNs have been shown to enhance immune function during bacterial, viral, and parasitic infections [5]. The mechanism of action of CpG ODNs in sepsis may be related to the enhancement of innate and adaptive immune responses, depending on the pathogen model studied. Our results are in opposition to those suggesting that CpG ODN therapy may worsen outcome in shock [30, 31]. Studies of macrophage activation by CpG DNA and the cloning of TLR9 have demonstrated that TLR9 activation by CpG ODNs enhanced lethality in mice sensitized with D-galactosamine. The use of D-galactosamine may not accurately recreate an environment similar to sepsis resulting from pathogen infection. Our findings correlate with those showing CpG-mediated protection from morbidity and mortality after pathogenic infection [10, 11].
The ability of CpG ODNs to provide protection in sepsis at the time of CLP and after CLP may be related to the specific model of sepsis and the species used for the study. Our study employed a rat model rather than the previously studied mouse and chicken extracellular infection models [10, 11]. It is possible that species differences could account for the enhanced protection conferred by CpG ODNs in our study, compared with that in previous studies [10, 11]. Also, the use of CpG ODNs has not yet been reported in conjunction with the CLP model. Previous studies of CpG ODN protection from extracellular infections have employed models of cellulitis and peritoneal infection via cecal ascending stent peritonitis (CASP) [10, 11]. The CASP model is significantly different from the CLP model. The CASP procedure utilizes placement of a stent that allows communication between the cecal contents and the peritoneal cavity. The CASP model induces peritoneal infection via the leakage of fecal material. The CLP model utilizes ligation of the cecum, with the cecal perforation distal to the ligated portion of the colon. The ligated cecum itself may become necrotic and generate an inflammatory response in addition to that generated by the leaking fecal material. This is the mechanism postulated to explain the observed increase in mortality that is proportional to the amount of cecum ligated, when the CLP model is used [32]. Since the CASP model does not have this secondary inflammatory insult due to the ligated cecum, it is likely a less aggressive model of sepsis. Because of the significant differences in the models used for the study of CpG ODN protection, it is difficult to compare their results directly, since the mechanism of protection may differ slightly in each model system studied.
Prior studies have suggested that the effects of CpG pretreatment were due to the enhancement of innate immune effector-cell function [11]. The mechanism accounting for functional up-regulation of innate immune cells by CpG ODNs is unclear. CpG ODNs could have direct effects on innate immune cells; however, the TLR9 receptor is most prominently expressed on DCs and macrophages in the murine system [33]. Clearly, differences exist between human and murine cells in the expression of TLR9. Current understanding of TLR9 expression comes largely from studies of isolated, quiescent cells. TLR9 expression may be induced after cell stimulation with exogenous agents [34]. Expression of TLR9 is not completely characterized in humans and mice during sepsis. It is unknown whether TLR9 may be induced on cell populations during the development of the sepsis response. It is possible that TLR9 could be induced on various cell types in a compartmentalized manner during the development of sepsis, since there is dynamic modification of the immune response during this period. It was recently shown that human PMNLs may express TLR9 and that PMNLs may differentiate, depending on host circumstances, to respond to TLR9 ligands [34, 35, 36]. Expression of TLR9 on rodent PMNLs has not been documented, although it is possible that improved outcome in sepsis in our model system could be due to enhanced innate immune function via stimulation of PMNL TLR9, if present. Therefore, it is difficult to extrapolate the utility of CpG ODNs to the treatment of human sepsis on the basis of current knowledge of restricted TLR9 expression. Such extrapolation will require characterization of TLR9 expression and CpG ODN effects during the development of sepsis in each experimental model system (CLP vs. CASP), as well as in each source of human sepsis (pneumonia vs. ip infection).
Since our findings suggested that CpG ODNs enhanced expression of IL-23 p40, we sought to determine whether IL-17 could possibly represent a cytokine bridge between the TLR9-bearing cell population and innate immune effector cells responsive to IL-17. The increase in expression of p40 suggests an initial mechanism of interaction between macrophages/DCs and T cells or PMNLs during early bacterial sepsis. It was recently shown that IL-23 is responsible for increases in T cell secretion of IL-17 [19]. On the basis of this finding, it is possible that CpG ODNs activate T cells or PMNLs via IL-23 produced by macrophages or DCs during early sepsis. Subsequent IL-17 release from T cells or PMNLs might then feed back on cells involved with the innate immune response, producing a complete communication network loop. The amplification of this T cellinnate immune cell network represents a potential novel point of therapeutic intervention in sepsis by use of CpG ODNs. However, since we were unable to measure p19 protein expression directly, it is possible that our observed outcomes result from the activity of p40 homodimers rather than of the IL-23 heterodimer p19/p40 [37].
Our results suggest that IL-17 expression or function may be required for the full effect of CpG ODN therapy and suggest a possible role for IL-17 as a regulator of the host response to bacterial sepsis. IL-17 is known to play a role in the formation of ip abscesses and adhesion formation during experimental infection [21]. Results of another study suggest that inhibition of IL-12 may lead to reduced abscess formation during CLP [38]. These observations suggest a hypothesis whereby maintenance of adequate IL-12/23 p40 and IL-17 expression or function is required for survival from CLP sepsis. Our model of CpG ODN therapy highlights the potential link between IL-12/23 p40 expression and IL-17 function in the containment of peritoneal bacterial infection.
We did not detect differences in IL-17 levels in peritoneal fluid in CpG and non-CpG ODNtreated rats (data not shown). Results of a prior study of the role of IL-17 in the formation of peritoneal abscesses suggest that it may be produced and act in a localized manner [21]. Although our findings implicate IL-17 in the CpG ODN protective mechanism, it is possible that this is not a result of altered IL-17 levels. It is possible that CpG ODNs induce IL-17 receptor expression or function, which would explain the CpG ODNmediated IL-17dependent effect indirectly. We did not address the source of IL-17 involved in the protective CpG mechanism during sepsis in our model. The predominant source and role of IL-17 during intraabdominal infections remain unknown. Previous work has suggested that IL-17 derived from CD4+ T cells is required for effective abscess formation in a murine model of bacterial implantation [21]. The specific role of PMNL-derived IL-17 in abscess formation is undefined. However, since PMNLs are recruited to the peritoneal cavity and infection site, it is possible that they also contribute local IL-17 to the inflammatory process.
Our results suggest that CpG ODN therapy for sepsis reduces lung inflammation. The reduction in MPO activity was correlated with a reduction in mononuclear cell interstitial infiltration after CpG ODN administration. These findings are consistent with published findings that macrophages represent a significant source of MPO and also are required for PMNL recruitment to lung [39, 40]. The ability of CpG ODNs to prevent sepsis-induced lung inflammation has not been described. Previous studies have shown that CpG ODNs may induce lung inflammation if they are directly applied to lung via the tracheal route [41]. These studies did not evaluate the effect of CpG ODNs on lung infection or the effect of indirect CpG ODN administration on lung inflammation. Direct use of CpG ODNs during lung infection has not been documented. Our model does not allow determination of whether CpG ODN therapy directly or indirectly reduces lung inflammation after CLP. Regardless, our results suggest that CpG ODN administration at sites distant from lung does not promote generalized inflammation during the development of sepsis. Our findings and the documented ability of CpG ODNs to prevent asthma-induced lung inflammation suggest that the context of CpG ODN administration is an important contributor to the final physiologic outcome [42].
Prior studies have suggested that lymphocyte and DC apoptosis are detrimental sequelae of sepsis [3, 43]. CpG ODNs may prevent or induce apoptosis, depending on the ODN structure [29, 44]. ODNs containing a 5 CpG motif may induce apoptosis through a mitochondrial-dependent mechanism in isolated T leukemia cells [44]. However, ODNs containing a central CpG motif may prevent DC and B cell apoptosis directly in vitro [29]. The function of CpG ODNs in vivo is unknown. Our data suggest that the therapeutic application of CpG ODNs can inhibit late apoptosis of thymocytes induced by CLP. It is not clear from our experiments whether CpG ODNs inhibited apoptosis directly or indirectly. Direct inhibition of apoptosis by CpG ODNs has been described in vitro [29, 45]. However, indirect apoptosis is also possible in vivo, through the prevention of sepsis progression in the host. Future studies may clarify the action of CpG ODNs in preventing apoptosis in vivo during the development of sepsis.
References
1. Hotchkiss RS, Karl IE. The pathophysiology and treatment of sepsis. N Engl J Med 2003; 348:13850. First citation in article
2. Hotchkiss RS, Tinsley KW, Swanson PE, et al. Sepsis-induced apoptosis causes progressive profound depletion of B and CD4+ T lymphocytes in humans. J Immunol 2001; 166:695263. First citation in article
3. Hotchkiss RS, Tinsley KW, Swanson PE, et al. Depletion of dendritic cells, but not macrophages, in patients with sepsis. J Immunol 2002; 168:2493500. First citation in article
4. Hotchkiss RS, Chang KC, Swanson PE, et al. Caspase inhibitors improve survival in sepsis: a critical role of the lymphocyte. Nat Immunol 2000; 1:496501. First citation in article
5. Klinman DM. Immunotherapeutic uses of CpG oligodeoxynucleotides. Nat Rev Immunol 2004; 4:24958. First citation in article
6. Mutwiri G, Pontarollo R, Babiuk S, et al. Biological activity of immunostimulatory CpG DNA motifs in domestic animals. Vet Immunol Immunopathol 2003; 91:89103. First citation in article
7. Hacker G, Redecke V, Hacker H. Activation of the immune system by bacterial CpG-DNA. Immunology 2002; 105:24551. First citation in article
8. Sparwasser T, Koch ES, Vabulas RM, et al. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur J Immunol 1998; 28:204554. First citation in article
9. Klinman DM, Yi AK, Beaucage SL, Conover J, Krieg AM. CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon . Proc Natl Acad Sci USA 1996; 93:287983. First citation in article
10. Gomis S, Babiuk L, Godson DL, et al. Protection of chickens against Escherichia coli infections by DNA containing CpG motifs. Infect Immun 2003; 71:85763. First citation in article
11. Weighardt H, Feterowski C, Veit M, Rump M, Wagner H, Holzmann B. Increased resistance against acute polymicrobial sepsis in mice challenged with immunostimulatory CpG oligodeoxynucleotides is related to an enhanced innate effector cell response. J Immunol 2000; 165:453743. First citation in article
12. Yao Z, Painter SL, Fanslow WC, et al. Human IL-17: a novel cytokine derived from T cells. J Immunol 1995; 155:54836. First citation in article
13. Moseley TA, Haudenschild DR, Rose L, Reddi AH. Interleukin-17 family and IL-17 receptors. Cytokine Growth Factor Rev 2003; 14:15574. First citation in article
14. Ferretti S, Bonneau O, Dubois GR, Jones CE, Trifilieff A. IL-17, produced by lymphocytes and neutrophils, is necessary for lipopolysaccharide-induced airway neutrophilia: IL-15 as a possible trigger. J Immunol 2003; 170:210612. First citation in article
15. Jovanovic DV, Di Battista JA, Martel-Pelletier J, et al. IL-17 stimulates the production and expression of proinflammatory cytokines, IL- and TNF-, by human macrophages. J Immunol 1998; 160:351321. First citation in article
16. Witowski J, Pawlaczyk K, Breborowicz A, et al. IL-17 stimulates intraperitoneal neutrophil infiltration through the release of GRO chemokine from mesothelial cells. J Immunol 2000; 165:581421. First citation in article
17. Ye P, Rodriguez FH, Kanaly S, et al. Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J Exp Med 2001; 194:51927. First citation in article
18. Chabaud M, Fossiez F, Taupin JL, Miossec P. Enhancing effect of IL-17 on IL-1-induced IL-6 and leukemia inhibitory factor production by rheumatoid arthritis synoviocytes and its regulation by Th2 cytokines. J Immunol 1998; 161:40914. First citation in article
19. Happel KI, Zheng M, Young E, et al. Cutting edge: roles of Toll-like receptor 4 and IL-23 in IL-17 expression in response to Klebsiella pneumoniae infection. J Immunol 2003; 170:44326. First citation in article
20. Chung DR, Chitnis T, Panzo RJ, Kasper DL, Sayegh MH, Tzianabos AO. CD4+ T cells regulate surgical and postinfectious adhesion formation. J Exp Med 2002; 195:14718. First citation in article
21. Chung DR, Kasper DL, Panzo RJ, et al. CD4+ T cells mediate abscess formation in intra-abdominal sepsis by an IL-17-dependent mechanism. J Immunol 2003; 170:195863. First citation in article
22. Walker PS, Scharton-Kersten T, Krieg AM, et al. Immunostimulatory oligodeoxynucleotides promote protective immunity and provide systemic therapy for leishmaniasis via IL-12- and IFN--dependent mechanisms. Proc Natl Acad Sci USA 1999; 96:69705. First citation in article
23. Vakeva AP, Agah A, Rollins SA, Matis LA, Li L, Stahl GL. Myocardial infarction and apoptosis after myocardial ischemia and reperfusion: role of the terminal complement components and inhibition by anti-C5 therapy. Circulation 1998; 97:225967. First citation in article
24. Guo RF, Huber-Lang M, Wang X, et al. Protective effects of anti-C5a in sepsis-induced thymocyte apoptosis. J Clin Invest 2000; 106:127180. First citation in article
25. Hochrein H, Shortman K, Vremec D, Scott B, Hertzog P, O'Keeffe M. Differential production of IL-12, IFN-, and IFN- by mouse dendritic cell subsets. J Immunol 2001; 166:544855. First citation in article
26. Trinchieri G, Pflanz S, Kastelein RA. The IL-12 family of heterodimeric cytokines: new players in the regulation of T cell responses. Immunity 2003; 19:6414. First citation in article
27. Oppmann B, Lesley R, Blom B, et al. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity 2000; 13:71525. First citation in article
28. Hotchkiss RS, Tinsley KW, Karl IE. Role of apoptotic cell death in sepsis. Scand J Infect Dis 2003; 35:58592. First citation in article
29. Park Y, Lee SW, Sung YC. Cutting edge: CpG DNA inhibits dendritic cell apoptosis by up-regulating cellular inhibitor of apoptosis proteins through the phosphatidylinositide-3-OH kinase pathway. J Immunol 2002; 168:58. First citation in article
30. Hemmi H, Takeuchi O, Kawai T, et al. A Toll-like receptor recognizes bacterial DNA. Nature 2000; 408:7405. First citation in article
31. Sparwasser T, Miethke T, Lipford G, et al. Macrophages sense pathogens via DNA motifs: induction of tumor necrosis factor-alpha-mediated shock. Eur J Immunol 1997; 27:16719. First citation in article
32. Singleton KD, Wischmeyer PE. Distance of cecum ligated influences mortality, tumor necrosis factor-alpha and interleukin-6 expression following cecal ligation and puncture in the rat. Eur Surg Res 2003; 35:48691. First citation in article
33. Rothenfusser S, Tuma E, Endres S, Hartmann G. Plasmacytoid dendritic cells: the key to CpG. Hum Immunol 2002; 63:11119. First citation in article
34. Hayashi F, Means TK, Luster AD. Toll-like receptors stimulate human neutrophil function. Blood 2003; 102:2660935. First citation in article
35. Trevani AS, Chorny A, Salamone G, et al. Bacterial DNA activates human neutrophils by a CpG-independent pathway. Eur J Immunol 2003; 33:316474. First citation in article
36. Tsuda Y, Takahashi H, Kobayashi M, Hanafusa T, Herndon DN, Suzuki F. Three different neutrophil subsets exhibited in mice with different susceptibilities to infection by methicillin-resistant Staphylococcus aureus. Immunity 2004; 21:21526. First citation in article
37. Mattner F, Ozmen L, Podlaski FJ, et al. Treatment with homodimeric interleukin-12 (IL-12) p40 protects mice from IL-12-dependent shock but not from tumor necrosis factor alpha-dependent shock. Infect Immun 1997; 65:47347. First citation in article
38. Steinhauser ML, Hogaboam CM, Lukacs NW, Strieter RM, Kunkel SL. Multiple roles for IL-12 in a model of acute septic peritonitis. J Immunol 1999; 162:543743. First citation in article
39. Rodrigues MR, Rodriguez D, Russo M, Campa A. Macrophage activation includes high intracellular myeloperoxidase activity. Biochem Biophys Res Comm 2002; 292:86973. First citation in article
40. Maus UA, Waelsch K, Kuziel WA, et al. Monocytes are potent facilitators of alveolar neutrophil emigration during lung inflammation: role of the CCL2-CCR2 axis. J Immunol 2003; 170:32738. First citation in article
41. Schwartz DA, Quinn TJ, Thorne PS, Sayeed S, Yi AK, Krieg AM. CpG motifs in bacterial DNA cause inflammation in the lower respiratory tract. J Clin Invest 1997; 100:6873. First citation in article
42. Sur S, Wild JS, Choudhury BK, Sur N, Alam R, Klinman DM. Long term prevention of allergic lung inflammation in a mouse model of asthma by CpG oligodeoxynucleotides. J Immunol 1999; 162:628493. First citation in article
43. Hotchkiss RS, Schmieg RE Jr, Swanson PE, et al. Rapid onset of intestinal epithelial and lymphocyte apoptotic cell death in patients with trauma and shock. Crit Care Med 2000; 28:320717. First citation in article
44. Tidd DM, Spiller DG, Broughton CM, Norbury LC, Clark RE, Giles RV. Oligodeoxynucleotide 5mers containing a 5-CpG induce apoptosis through a mitochondrial mechanism in T lymphocytic leukaemia cells. Nucleic Acids Res 2000; 28:224250. First citation in article
45. Manzel L, Macfarlane DE. CpG-oligodeoxynucleotide supports growth of IL-6-dependent 7TD1 murine hybridoma cells. Life Sci 1998; 62:237. First citation in article