点击显示 收起
Department of Molecular Genetics and Microbiology and Clinical Microbiology Laboratory, Department of Pathology, Duke University Medical Center, Durham, North Carolina
National Health Laboratory, Ministry of Health, Gaborone, Botswana
Cryptococcus gattii is a group of exogenous, neurotropic yeasts that possess the capsular serotype B or C. Isolates of serotype C are extremely rare and, until recently, were known to infect only immunocompetent individuals. We genotyped 176 isolates of Cryptococcus from patients in sub-Saharan Africa who had AIDS; 22 (13.7%) of 161 isolates from Botswana and 2 (13.3%) of 15 isolates from Malawi were C. gattii serotype C strains. All of these serotype C strains belong to the rare VGIV genotype, possess the MAT mating-type allele, and exhibit little genetic diversity.
The Cryptococcus neoformansspecies complex includes basidiomycetous yeasts that cause systemic infections in both immunocompromised and immunocompetent individuals [1]. However, most patients who acquire cryptococcosis have impaired cellular immunity and are infected with either C. neoformans var. grubii or C. neoformans var. neoformans; these varieties, which include serotypes A and D and AD hybrids, are globally responsible for 98% of all cryptococcal infections in patients with AIDS. Conversely, C. gattii, which has been accorded species status [2], includes serotypes B and C, predominantly infects immunocompetent individuals, and, until recently, had not been reported in patients with AIDS.
Little is known about the epidemiology and physiology of serotype C isolates. Most clinical serotype C strains were isolated from immunocompetent patients in southern California [3]; in addition, there are reports of the isolation of serotype C from immunocompetent patients in Canada [3], the United Kingdom [3], Thailand [4], Mexico [5], Brazil [6], and Colombia [7]. On the basis of molecular fingerprinting, all serotype C strains have been associated with either of 2 genetically isolated molecular types, VGIII and VGIV [5]. Most isolates possess the VGIII molecular type, and they have been isolated in the United States, India, and South America [5]; isolates of the VGIV type are extremely rare but are found in South Africa, India, Mexico, and Colombia [5, 8].
Recent reports have suggested that infection with serotype C strains may be associated with AIDS in patients in sub-Saharan Africa. In 2002, 4 cases of cryptococcal meningitis were reported from South Africa, and they were caused by C. gattii serotype C strains [9]. In addition, 8 patients with AIDS and cryptococcosis caused by C. gattii were reported from Rwanda, but the serotypes of these isolates were not indicated [10].
We examined isolates of Cryptococcus from specimens of spinal fluid from 161 Botswanan patients and 15 Malawian patients, all of whom had AIDS. As expected, most of these isolates were C. neoformans var. grubii serotype A, but 22 (13.7%) of the 161 Botswanan and 2 (13.3%) of the 15 Malawian strains were serotype C. All of the serotype C strains have the rare VGIV molecular type and possess the MAT mating-type allele. By analyzing amplified fragment-length polymorphisms (AFLP) and sequences of the intergenic spacer (IGS) region of rDNA, we discerned 10 distinct genotypes among the serotype C strains. However, there was little genetic diversity among these strains, which implies that they most likely descended from a single lineage.
Genomic DNA was extracted from each isolate, and AFLP markers were generated as described elsewhere [12]. Polymorphic bands were defined as bands of the same size that were present in some but not all isolates. To assess the reproducibility of the AFLP method, DNA was extracted and the AFLP reactions and analyses were performed on at least 3 separate occasions, for each isolate. In comparisons of replicate analyses, 98% of the AFLP bands were identical (data not shown). Only intense and reproducible bands were scored for the analyses of population structure. For each strain, the IGS1 region between the large subunit of rDNA and the 5S genes was obtained by PCR and was sequenced [12, 13].
The mating type of each strain was identified by PCR using the following mating typespecific primers, which amplified portions of either the STE3a allele or the STE3 allele: (1) STE3aforward, 5-ACCTTTGCGGTTTCATCAAC; reverse, AAGGTCGCATGGGTAATGAG; and (2) STE3forward, 5-TAACATTGGACATCCCAGCA; reverse, 5-GAAGACGCAGGGTACAGCTC. The conditions for these amplifications were as follows: STE3a94°C for 5 min, followed by 30 cycles of 94°C for 30 sec, 56°C for 30 sec, and 72°C for 1 min, followed by extension at 72°C for 7 min; and STE394°C for 5 min, followed by 30 cycles of 94°C for 30 sec, 62°C for 30 sec, and 72°C for 1 min, followed by extension at 72°C for 7 min. Each reaction contained PCR buffer, 2 mmol/L MgCl2, 0.2 mmol/L each deoxyribonucleoside triphosphate, 1 mol/L each primer, 0.065 L Taq DNA Polymerase (Invitrogen), and 1 ng genomic DNA. To test for sexual reproduction and to determine mating types, the strains were crossed, in the laboratory, with MMRL 1343 serotype C MATa and with MMRL 1332 serotype C MAT, as described elsewhere [12].
Genetic relatedness among the isolates was evaluated by 2 methods: (1) nonmetric multidimensional scaling analysis using Euclidian-distance measures and Community Analysis Package 2.4 (PISCES Conservation) and (2) Nei-Li genetic distances for restriction-fragment data, followed by cluster analysis using the neighbor-joining algorithm in the Phylogenetic Analysis Using Parsimony (PAUP) program [12, 13].
Phylogenetic analyses of the IGS1-sequence data were also performed by use of PAUP. Maximum-parsimony trees were identified by use of heuristic searches based on 100 random sequence additions for each data set. To evaluate the association among loci in each sample, we used the index of association (IA) and the new unbiased estimate of multilocus linkage disequilibrium (rd) [12, 13]; both the IA values and the rd values were calculated by use of Multilocus 1.2 software, and 1000 artificially recombined data sets were used to determine the statistical (bootstrap) values for the test [12, 13].
Results and discussion.
Among the spinal-fluid isolates of Cryptococcus from 161 Botswanan patients with AIDS and the blood isolates from 15 Malawian patients with AIDS, we identified 24 C. gattii serotype C strains. The strains were serotyped by use of commercial Mabs (Iatron), and their serotypes were confirmed by serotype-specific PCR and AFLP analysis [12]. The Botswanan sample consisted of 139 isolates (86.3%) that were serotype A and 22 isolates (13.7%) that were serotype C; the Malawian sample consisted of 12 isolates (80%) that were serotype A, 2 isolates (13.3%) that were serotype C, and 1 isolate (6.7%) that was a serotype AD hybrid strain. None of the isolates were serotype B or serotype D. The serotype C strains are listed in table 1.
All 24 serotype C isolates were encapsulated, produced melanin on niger-seed agar, and grew at 37°C [1]. When cultured on canavanineglycinebromothymol blue agar, 23 of the 24 serotype C isolates changed the color of the medium from yellow-green to bright blue.
The mating type of each strain was identified by PCR using mating typespecific primers that amplified portions of either the STE3a allele or the STE3 allele, and the results were confirmed by mating assays [12]. Characteristic 600-bp amplicons were obtained by use of the primers specific to the STE3 allele but not by use of the primers specific to the STE3a allele (data not shown). In mating assays, only 1 of the strains, bt91, was fertile.
We used AFLP analysis with 2 independent primer pairs to investigate the genetic diversity of the isolates [12, 13]; 10 polymorphic AFLP bands distinguished 10 AFLP genotypes, and these genotypes were used to determine genetic relationships among the isolates (figure 1). DNA sequence analysis of the IGS1 region revealed that all but 1 of the isolates, bt21, had identical IGS1 sequences (data not shown), a result that confirms that AFLP genotyping is more discriminatory than is single-locus gene sequencing [12].
Using PCR fingerprinting, Meyer et al. defined 2 genetically distinct molecular types of serotype C, which they designated "VGIII" and "VGIV" [5]. Our AFLP and IGS1-sequence analyses of serotype C strains also delineated 2 distinct molecular types of serotype C, and the serotype C isolates from Botswana and Malawi that we delineated are closely related to the VGIV molecular type (figure 1). VGIV strains are rare, and reported sources of VGIV include an immunocompetent patient in Mexico and environmental samples from Colombia [5, 7]. In addition, Ellis et al. reported the isolation of VGIV strains from South Africa and India, although they did not indicate either the number or the source of these strains [8].
Analyzing the clone-corrected data set, we detected statistically significant linkage disequilibrium among the alleles (IA = 0.73; P < .01), which suggests that there is significant clonality among the isolates. A low level of genetic diversity among serotype C strains was also observed in a multigene phylogenetic analysis of 6 strains [14].
With few exceptions, C. gattii serotype B or C strains are typically found in tropical and subtropical areas of the world and are usually associated with primary infections in immunocompetent patients [1]. One of the exceptions is the recent cluster of infections caused by serotype B that were found in immunocompetent persons in Vancouver, British Columbia; the vast majority of these cases were caused by serotype B strains with an identical genotype and the mating type [15, 16]. Compared with cases of cryptococcosis caused by serotypes A and D, those caused by serotypes B and C exhibit more pulmonary and cerebral nodules, increased neurological morbidity, and slower response to antifungal therapy [17]. Our investigation has revealed that a significant proportion of opportunistic cryptococcal infections in Botswanan and Malawian patients with AIDS are attributable to serotype C strains, which may explain, in part, the substantial gravity of cryptococcal meningoencephalitis in sub-Saharan Africa. Because these strains were recovered from either spinal-fluid or blood specimens from patients with AIDS, we do not know the extent to which they may cause nonneurological or non-AIDSassociated cryptococcosis in Botswana and Malawi.
This newly discovered association with meningeal cryptococcosis caused by C. gattii serotype C in patients in Botswana, Malawi, and South Africa who have AIDS may be a localized phenomenon. Indeed, no additional serotype C strains were discovered in a preliminary screening of 13 clinical isolates from Tanzania, 21 from Uganda, and 5 from the Democratic Republic of Congo (data not shown). However, it would be surprising if these strains were not more widespread in sub-Saharan Africa.
Because of the high prevalence of HIV infection in Botswana and Malawi, a large percentage of their populations continue to be at risk for infection with indigenous Cryptococcus strains. The present report demonstrates that C. gattii serotype C strains are clearly more abundant in Africa than had previously been thought [9]. In the natural environment, C. gattii serotype B has been associated with a variety of trees, particularly with species of Eucalyptus [1], and several such speciesincluding E. camaldulensis, E. tereticornis, and E. sideroxylonare found in Botswana. However, the ecological reservoir of serotype C has not been determined; there is only a single report that describes the isolation of C. gattii serotype C from the environmentan almond tree (Terminalia catappa) in Colombia [7]. Environmental isolates will be necessary for investigation of the source of isolates of serotype C from patients in Africa.
Acknowledgments
We greatly appreciate the technical assistance of Lori Kestenbaum. We are grateful to Arvind A. Padhye (Centers for Disease Control and Prevention, Atlanta, Georgia), Wiley Schell (Medical Mycological Research Laboratory, Duke University Medical Center, Durham, NC), Wieland Meyer (Centre for Infectious Diseases and Microbiology, Westmead Hospital, Sydney, Australia), and Teun Boekhout (Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands), for providing the cultures.
References
1. Casadevall A, Perfect JR. Cryptococcus neoformans. Washington, DC: ASM Press, 1999. First citation in article
2. Kwon-Chung KJ, Boekhout T, Fell JW, Diaz M. Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. bacillisporus (Basidiomycota, Hymenomycetes, Tremellomycetidae). Taxon 2004; 51:8046. First citation in article
3. Kwon-Chung KJ, Bennett JE. Epidemiologic differences between the two varieties of Cryptococcus neoformans. Am J Epidemiol 1984; 120:12330. First citation in article
4. Sukroongreung S, Nilakul C, Ruangsomboon O, Chuakul W, Eampokalap B. Serotypes of Cryptococcus neoformans isolated from patients prior to and during the AIDS era in Thailand. Mycopathologia 1996; 135:758. First citation in article
5. Meyer W, Castaeda A, Jackson S, Huynh M, Castaeda E. Molecular typing of IberoAmerican Cryptococcus neoformans isolates. Emerg Infect Dis 2003; 9:18995. First citation in article
6. Nishikawa MM, Lazéra MS, Barbosa GG, et al. Serotyping of 467 Cryptococcus neoformans isolates from clinical and environmental sources in Brazil: analysis of host and regional patterns. J Clin Microbiol 2003; 41:737. First citation in article
7. Callejas A, Ordonez N, Rodriguez MC, Castaeda E. First isolation of Cryptococcus neoformans var. gattii, serotype C, from the environment in Colombia. Med Mycol 1998; 36:3414. First citation in article
8. Ellis DH, Marriott D, Hajjeh RA, Warnock DW, Meyer W, Barton RC. Epidemiology: surveillance of fungal infections. Med Mycol 2000; 38(Suppl):17382. First citation in article
9. Karstaedt AS, Crewe-Brown HH, Dromer F. Cryptococcal meningitis caused by Cryptococcus neoformans var. gattii, serotype C, in AIDS patients in Soweto, South Africa. Med Mycol 2002; 40:711. First citation in article
10. Bogaerts J, Rouvroy D, Taelman H, et al. AIDS-associated cryptococcal meningitis in Rwanda (19831992): epidemiologic and diagnostic features. J Infect 1999; 39:327. First citation in article
11. Bell M, Archibald LK, Nwanyanwu O, et al. Seasonal variation in the etiology of bloodstream infections in a febrile inpatient population in a developing country. Int J Infect Dis 2001; 5:639. First citation in article
12. Litvintseva AP, Marra RE, Nielsen K, Heitman J, Vilgalys RJ, Mitchell TG. Evidence of sexual recombination among Cryptococcus neoformans serotype A isolates in sub-Saharan Africa. Eukaryot Cell 2003; 2:11628. First citation in article
13. Litvintseva AP, Kestenbaum L, Vilgalys RJ, Mitchell TG. Comparative analysis of environmental and clinical populations of Cryptococcus neoformans. J Clin Microbiol 2005; 43:55664. First citation in article
14. Sugita T, Ikeda R, Shinoda T. Diversity among strains of Cryptococcus neoformans var. gattii as revealed by a sequence analysis of multiple genes and a chemotype analysis of capsular polysaccharide. Microbiol Immunol 2001; 45:75768. First citation in article
15. Fraser JA, Subaran RL, Nichols CB, Heitman J. Recapitulation of the sexual cycle of the primary fungal pathogen Cryptococcus neoformans var. gattii: implications for an outbreak on Vancouver Island, Canada. Eukaryot Cell 2003; 2:103645. First citation in article
16. Kidd SE, Hagen F, Tscharke RL, et al. A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Columbia, Canada). Proc Natl Acad Sci USA 2004; 101:1725863. First citation in article
17. Sorrell TC. Cryptococcus neoformans variety gattii. Med Mycol 2001; 39:15568. First citation in article