点击显示 收起
the Department of Medicine-Nephrology (L.Z., J.C., Y.M., J.Z., J.D.), Baylor College of Medicine, Houston, Tex
Molecular Endocrinology (W.T.), Baker Heart Research Institute, Melbourne, Victoria, Australia.
Abstract
Activation of nuclear factor (NF)-B by angiotensin II (Ang II) plays an essential role in stimulating expression of vascular adhesion molecules, which are essential for vascular inflammation. We report that Ang II activates NF-B by phosphorylating its p65 subunit via a pathway mediated partially by ribosomal S6 kinase (RSK). In investigating other pathway(s) that may be involved, we found that the ability of Ang II to activate NF-B in mouse embryonic fibroblast is suppressed (&70%) either by deletion of IB Kinase (IKK) or by inhibiting or knocking down IKK in vascular smooth muscle cells using a dominant-negative IKK adenovirus or small interference RNA to IKK. Thus, Ang II also stimulates NF-B via IKK. In vitro, we found that Ang II stimulates IKK to phosphorylate myelin basic protein and the p65 subunit of NF-B. The mechanism by which Ang II activates IKK is to increase phosphorylation of IKK in its activation loop (Ser181) rather than IB phosphorylation. Inhibiting both the RSK and IKK pathways completely blocks the Ang IIeCinduced p65 phosphorylation and NF-B activation. These 2 pathways are independent: inhibiting IKK does not block Ang IIeCinduced phosphorylation of RSK, whereas inhibiting mitogen-activated protein kinase 1 does not affect phosphorylation of IKK. Finally, we found that Ang II can induce expression of vascular adhesion molecules by 2 pathways; both IKK and RSK lead to phosphorylation of the p65 subunit of NF-B to increase vascular cell adhesion molecule-1 transcription. The 2 pathways are functionally important because inhibiting IKK and RSK in vascular smooth muscle cells blocks Ang IIeCinduced expression of vascular cell adhesion molecule-1 and intercellular adhesion molecule-1 to limit vascular inflammation.
Key Words: angiotension II cell signaling nuclear factor B
Introduction
Nuclear factor (NF)-B activation by classic cytokines (eg, tumor necrosis factor -) requires serine phosphorylation, ubiquitination, and degradation of IB by the proteasome, resulting in the release of NF-B.1 This proceeds by phosphorylation of IB via an IB kinase (IKK).2 The proinflammatory effect of angiotensin II (Ang II) also involves activation of NF-B in vascular smooth muscle cells (VSMCs),3 but the mechanism is different because Ang II induces minimal phosphorylation and degradation of IB.4eC6 Earlier, we reported that Ang II activates NF-B by phosphorylating its p65 subunit, rather than promoting IB degradation.7 This is important because others have shown that phosphorylation of p65 at multiple serine sites increases the transcriptional capacity of NF-B in the nucleus.8eC11 Specifically, phosphorylation of p65 at serine 536 increases transactivation of NF-B, whereas mutation of this serine to alanine impairs cytokine-induced stimulation of NF-B.12
Previously, we showed that Ang II induces phosphorylation of p65 in VSMCs partly by activating the Ras/mitogen-activated protein kinase (MAPK) pathway and its downstream effecter, ribosomal S6 kinase (RSK).7 However, when we inhibited the MAPK/RSK pathway, we found only partial blockade of the Ang IIeCinduced phosphorylation of p65 and NF-B promoter activity. Therefore, another pathway(s) must mediate p65 phosphorylation and activation of NF-B.
In part, activation of NF-B by Ang II involves reactive oxygen species (ROS)-signaling cascades in VSMCs,13 although the redox-sensitive target(s) remains unclear. One possibility is IKK, because it was recently discovered that IKK phosphorylates substrates other than IB, such as insulin receptor substrate-1 and steroid receptor coactivator-3, as well as p65.14eC16 Therefore, we examined whether alternative kinase activities of IKK will stimulate NF-B. We found 2 pathways by which Ang II can activate NF-B. Both activated RSK, and IKK can stimulate phosphorylation of p65 and activate NF-B, and these pathways can cooperate to produce maximal NF-BeCmediated responses.
Materials and Methods
Cell Culture and Antibodies
Both rat aortic VSMCs17 and mouse embryonic fibroblast (MEF) cells (derived from mice null in IKK and IKK) were cultured in DMEM) supplemented with 10% FBS. Antibodies against phospho-IKK (Ser181), phospho-IB (Ser32/36), phospho-p44/42 (Thr202/Tyr204) MAPK, phospho-NF-B p65 (Ser536), and IB were bought from Cell Signaling (Beverly, Mass). Antibodies against vascular cell adhesion molecule (VCAM), intracellular adhesion molecule (ICAM), IKK, and IKK were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif). The -actin antibody was purchased from Sigma Aldrich (St Louis, Mo).
NF-B Activity Assay
NF-B transcriptional activity was evaluated using a NF-B-luc reporter vector as described.18
In Vitro Kinase Assay
VSMCs were cultured to 95% confluence and then serum starved for 24 hours before adding 100 nmol/L Ang II for 5 minutes. IKK and IKK were immunoprecipitated using antibodies from Santa Cruz Biotechnology. In vitro IKK activity was measured by incubating immunocomplexed IKK or IKK with different substrates: recombinant myelin basic protein (MBP) (Upstate) or other substrates (glutathione S-transferase -IB, GST-IB, GST-p65, or GST-p65 [Ser536A]) as described.7,18
Measurement of Intracellular Levels of ROS
Ninety-five percent confluent VSMCs were infected with an adenovirus, Ad.catalase or Ad.-gal (as control), for 24 hours before being serum starved for 24 hours. The cells were then loaded with 50 eol/L 2',7'-dichlorodihydro-fluorescein diacetate (H2DCF-DA) (Sigma Aldrich) for 15 minutes at 37°C. A change in the DCF fluorescence of Ang IIeCtreated and serum-free cells was recorded with an Flx-800 microplate fluorescence reader (Bio-Tek Instruments Inc, Winooski, Vt) at excitation/emission wavelengths of 485/528 nm. Changes in fluorescence are expressed as percentage increase relative to the intensity at time 0.
VSMC Transfection
VSMCs were transfected with 5 e of plasmid per 2x106 cells using Nucleofector reagent and electroporator (AMAXA, San Diego).
Electrophoretic Mobility-Shift Analysis
Nuclear extracts from VSMCs were prepared as described.7 The oligonucleotide containing the NF-B consensus sequence (eC153 to eC188) in VCAM promoter (5'-TGCCCTGGGTTTCCCCTTGAAGGGATTTCCCTCCG-3') was labeled by -32dCTP. Specificity of binding was tested by incubating with 100-fold molar excess of unlabeled probe or a classic NF-B probe (Promega, Madison, Wis).
VCAM-1 Promoter Activity Assay
The VCAM-1-luc plasmid was constructed by PCR amplifying the human VCAM-1 promoter, a region spanning eC294 to +12 bp. It was cloned into pGL3-basic vector (Promega). This short promoter fully responds to Ang II and proinflammatory stimuli.19eC21 The mutation of NF-B sites within eC294 to +12 of VCAM promoter (VCAM-1-mut-luc) (GGGTTTCCCCGCCTTTCCGG and GGGATTTCCCGCCATTTCGG) were generated by PCR-mediated mutagenesis. Wild-type and mutated constructs were confirmed by automated DNA sequencing. VSMCs were transfected with 5 e of VCAM-1-luc by electroporation (AMAXA) for 24 hours and then rendered quiescent by incubating cells in serum-free media for 24 hours. The quiescent cells were treated with Ang II for 6 hours, and luciferase activities were determined as described.7
Densitometry of the blots was analyzed using NIH ImageJ. All values are means±SE. Statistical significance was assessed by 2-tailed Student’s t test or 1-way ANOVA.
Results
Ang II Activates NF-B Through an IKK Pathway
To determine whether IKK is involved in Ang II activation of NF-B, we expressed NF-B-luc and a dominant-negative IKK (Ad.IKK KM) or IKK (Ad.IKK KA) in VSMCs using recombinant adenoviruses. A green fluorescent protein (GFP)-expressing adenovirus was used as a control. As shown in Figure 1A, Ang IIeCinduced transcriptional activity of NF-B was significantly suppressed by expression of Ad.IKK KM (eC60.2±2.3%; P<0.05), Ad.IKK KA (eC65.3±7.4%, P<0.05), or both (eC71.4±2.8%, P<0.05) when compared with NF-B transcriptional activity measured in Ad.GFP (empty vector)-infected cells.
To confirm that IKK is involved in Ang II activation of NF-B, we measured NF-B activity in MEFs derived from mice that were null in IKK or IKK (IKKeC/eC or IKKeC/eC). Because MEFs express very low levels of Ang II type 1 (AT1) receptor, we infected these cells with an adenovirus encoding the recombinant AT1 receptor.22 The infection rate was 67%. We achieved successful reconstitution of the AT1 receptor because we found that Ang II induced phosphorylation of extracellular signaleCregulated kinase 1/2 in AT1 virus-infected MEFs (Figure 1B). Ang II induced a 6-fold increase in NF-B promoter activity in cells expressing IKKs and the AT1 receptor. In contrast, Ang IIeCinduced NF-B promoter activities in AT1-positive cells that did not express either IKK or IKK were only 1.6±0.1- or 2.7±0.1-fold (Figure 1C). These results demonstrate that Ang II activation of NF-B depends on IKKs. Notably, activation of NF-B by Ang II is dependent on both IKK and IKK. This is not surprising because IKK phosphorylates the catalytic subunit of IKK in the IKK complex, and this complex can phosphorylate downstream effectors/targets.18
We also confirmed that Ang II can activate NF-B in VSMCs through an IKK pathway. When we knocked down the level of IKK by using small interference RNA (SiRNA), we achieved &70% decrease in IKK level. There was at least a 50% reduction in NF-B promoter activity when VSMCs were exposed to Ang II (Figure 1D)
Ang II Induces Phosphorylation of IKK to Activate NF-B
Inflammatory stimuli increase the phosphorylation of multiple serine/threonine sites on IKK to regulate its activity positively or negatively.23 To understand the relationships among Ang II, IKK, and NF-B, we examined whether Ang II stimulated phosphorylation of IKK at serine 181, because phosphorylation of serine 181 is essential for dimerization and activation of the IKK complex.24 VSMCs were treated with different concentrations of Ang II (0 to 10 eol/L) or for different times (0 to 60 minutes), and the cell lysates were used for immunoblotting with antieCphospho-IKK Ser181. As shown in Figure 2A, even 1 nmol/L Ang II could increase IKK phosphorylation at serine 181. The stimulation of IKK phosphorylation by 100 nmol/L Ang II was maximal at 10 minutes and declined after 30 minutes (Figure 2B). Interestingly, TNF also induced phosphorylation of serine 181 on IKK, but the response to TNF was much smaller than the response to Ang II (Figure 2C). Next, we transfected MEFs that are null in IKK with the inactive IKK178/181 (AA)24 and compared Ang IIeCinduced NF-B promoter activity to this cell transfected with wild-type IKK. Expression of the wild-type IKK restored Ang II activation of NF-B in AT1-expressing MEF IKK-null cell (Figure 2D; 6.0±0.8-fold, P<0.05, n=4). NF-B activation was not restored in cells that expressed the mutated IKK178/181 (AA) (1.8±0.3 fold, P<0.05, n=4). These results indicate that phosphorylation of IKK at serine 181 is essential for Ang IIeCinduced activation of NF-B.
Ang IIeCStimulated IKK Activity Directly Phosphorylates p65 but Not IB
We used MBP as a substrate to examine the activity of IKK that was immunoprecipitated from Ang IIeCtreated VSMCs. As shown in Figure 3A, IKK activity was significantly increased after 5 and 10 minutes of exposure to Ang II. However, when the recombinant proteins GST-IB or GST-IB were used as substrates, Ang II induced a minimal phosphorylation of these potential substrates (Figure 3B). Moreover, there were no significant changes in phosphorylation and degradation of IB in VSMCs that were exposed to Ang II.7 In contrast, TNF treatment yielded extensive phosphorylation of recombinant IBs in an in vitro kinase assay (Figure 3B), and it also increased phosphorylation and degradation of IB in VSMCs.7
Earlier, we found that Ang II stimulates the phosphorylation of p65 on Ser536. As shown in Figure 3C, Ang II treatment of AT1-expressing MEFs stimulated phosphorylation of p65 at Ser536, whereas cells that were null in IKK or IKK had reduced p65 phosphorylation. Consistent with these results, we found that when recombinant GST-p65 (p65 WT) was used as an in vitro substrate, Ang II stimulated IKK activity to phosphorylate recombinant GST-p65 but did not phosphorylate a mutated version, p65Ser536A (Figure 3D). Therefore, Ang II stimulates IKK to change its substrate specificity from IB to p65 of NF-B in VSMCs.
Activation of IKK by Ang II Is Dependent on ROS
To elucidate a mechanism by which Ang II phosphorylates and activates IKK, we examined the role of ROS. As expected from earlier reports, we found that Ang II dramatically increased DCF-DA fluorescence (a measure of ROS activation) compared with VSMCs incubated without Ang II (Figure 4A). When catalase was overexpressed in VSMCs, the release of ROS was absent (Figure 4A).
To determine whether the Ang IIeCinduced increase in ROS production is responsible for IKK, and ultimately NF-B activation, we expressed catalase in VSMCs; catalase suppressed Ang IIeCinduced phosphorylation of IKK (Figure 4B), and Ang II stimulation of NF-B promoter activity was also partially blocked (Figure 4C).
Both IKK and MAPK Kinase-1 Are Involved in Ang IIeCInduced Activation of NF-B and Adhesion Molecule Expression
We compared the contributions of the IKK and MAPK kinase-1 (MEK1)/RSK pathways to Ang IIeCinduced phosphorylation of p65 and activation of NF-B. Inhibition of MEK1 in MEF cells that are null in IKK completely suppressed the NF-B response to Ang II (Figure 5A). In contrast, when we inhibited MEK1, by using the U0126 inhibitor alone, or IKK, by using dominant-negative IKK KA alone, there was only partial inhibition of NF-B activation. Inhibition of both IKK (by using a dominant-negative IKK) and MEK1 (by adding U0126) at the same time will completely suppress Ang IIeCinduced phosphorylation of p65 and the activation of NF-B (Figure 5B and 5C). These results indicate that both pathways coordinate Ang IIeCinduced activation of NF-B in VSMCs.
To test the physiological relevance of the Ang IIeCinduced IKK and MEK1 pathways, we examined the expression of both VCAM-1 and ICAM-1 in VSMCs that had been treated for 3 days with or without 100 nmol/L Ang II. Ang II increased the expression of VCAM-1 and ICAM-1 after 1 day, and their expression increased through 3 days (Figure 5D, top). Ang II induced the expression of VCAM-1 and ICAM-1 in a dose-dependent fashion (Figure 5D, bottom). We also exposed VSMCs to 100 nmol/L Ang II for a short period time (3 to 24 hours) and found that the earliest time of protein expression following Ang II exposure was 6 hours (24.3% increase; P=NS); after 18 hours, the increase was 228% (P<0.05) (Figure 5E). Inhibition of IKK or MEK1 partially blocked Ang IIeCinduced expression of VCAM-1 and ICAM-1 in VSMCs, whereas inhibiting both IKK and MEK1 completely blocked expression of VCAM-1 and ICAM-1 (Figure 5F).
To determine whether Ang II regulates VCAM transcription via a NF-B mechanism, we cloned the VCAM promoter (eC294/+12), which contains 2 NF-BeCbinding sites, into a luciferase vector. After 6 hours of exposure to Ang II, VCAM promoter activity increased &5-fold over control (Figure 5G). Site-specific mutation of both NF-BeCbinding sites within this VCAM promoter abolished the ability of Ang II to increase VCAM promoter activity (Figure 5G). In the nuclear extracts isolated from VSMC treated with Ang II, we found evidence for increased binding of NF-B to the NF-B sites in the VCAM promoter (Figure 5H). The Ang IIeCinduced NF-B binding was partially blocked when cells were treated to express a dominant-negative IKK. We conclude that Ang II increases VCAM expression through an IKK-regulated activation of NF-B. The mechanism is phosphorylation of p65.
Discussion
In response to cytokines such as TNF, NF-B is activated via a mechanism that involves activation of IKK and phosphorylation of IB, leading to IB degradation by the ubiquitineCproteasome system.1 We recently found that Ang II can activate NF-B more directly by inducing phosphorylation of its p65 subunit in VSMCs.7 This new mechanism involves a MEK1/RSK pathway and accounts for &70% of the Ang IIeCinduced phosphorylation of p65 and NF-B activation. We now provide evidence that Ang IIeCinduced phosphorylation of p65 can also be mediated by stimulating IKK activity in VSMCs. Together, the RSK and IKK pathways interact and mediate Ang IIeCinduced phosphorylation of the p65 component of NF-B and NF-B activation. The result is an increase in ICAM-1 and VCAM-1 expression in VSMCs.
Importantly, this second pathway that Ang II activates is dependent on IKK, because expression of a dominant-negative form of IKK or a deficiency of IKK reduces Ang IIeCinduced (&70%) stimulation of NF-B (Figure 1A and 1C). Notably, inhibition of both of the RSK and IKK pathways completely suppressed Ang II activation of NF-B. Because blocking the RSK pathway only partially inhibited Ang IIeCinduced NF-B transcriptional activity, we conclude that Ang II stimulates both IKK and RSK activities and that they act together to stimulate NF-B maximally and generate inflammatory responses in VSMCs (Figure 5A).
Interestingly, in VSMCs, neither the IKK nor RSK results in IB phosphorylation. Instead, the pathways result in stimulation of IKK to phosphorylate p65 preferentially. Unlike TNF-induced responses, Ang II does not stimulate phosphorylation or degradation of IB in cultured VSMCs.7 Second, TNF-induced IKK activity in VSMCs phosphorylates recombinant GST-IB (Figure 3B), but Ang IIeCstimulated IKK activity does not phosphorylate GST-IB, even though it phosphorylates MBP (Figure 3A and 3B). Third, Ang IIeCstimulated IKK activity in VSMCs directly phosphorylates recombinant p65-GST on Ser536 (Figure 3D). Lastly, in VSMCs stimulated by Ang II, neither IKK nor RSK phosphorylates recombinant GST-IB in vitro. Together, these results indicate that Ang II treatment of VSMCs changes the substrate specificity of IKK from the classical phosphorylation of IB to direct phosphorylation of p65. Our results also suggest that there is agonist-specific regulation of NF-B activity.
Our results are consistent with phosphorylation of IKK at serine 181 as an agonist-specific event in VSMCs. Compared with TNF (Figure 2C), Ang II induces a more rapid and stronger phosphorylation of IKK (Figure 2A and 2B). Based on these results, we speculate that agonist-specific phosphorylation of IKK on serine 181 may explain the change in IKK substrate specificity. In fact, others have identified specific phosphorylation sites in IKK that can regulate its activity positively or negatively.23 In support of this explanation, expression of IKK-containing mutations in serine sites 179/181 prevented the stimulation of NF-B activity by Ang II in AT1-expressing MEFs (Figure 2D). It will be interesting to determine how a difference in the IKK phosphorylation profiles induced by TNF and Ang II can change IKK substrate specificity.
What Ang IIeCstimulated pathways lead to phosphorylation and activation of IKK We examined the influence of the antioxidant catalase and found that it partially suppresses Ang IIeCinduced phosphorylation of IKK and p65, the activation of NF-B, and the expression of adhesion molecules. These results suggest that ROS must act upstream of IKK. Although we did not examine this possibility in depth, others25,26 have pointed out that the apoptosis signaleCregulating kinase-1 (ASK1) can be activated by Ang II via a generation of ROS and that activated ASK1 can cause NF-B activation. Because ASK1 is a member of the MEK kinase family, several reports have concluded that MEK kinases can phosphorylate IKK.27 Thus, ASK1 could be a redox-sensitive upstream kinase that activates IKK in response to Ang II. When both IKK and RSK are inhibited, the effects of Ang II on IKK, p65, and NF-B and the expression of adhesion molecules are completely suppressed. These results suggest that activation of both IKK and RSK is physiologically important in regulating NF-B transcriptional activity by Ang II.
In summary, we have identified 2 pathways that activate NF-B in VSMCs. The redox-dependent activation of the IKK and MEK1/RSK pathways can act in a tissue-specific, coordinated fashion to phosphorylate and activate p65 directly, rather than acting through degradation of IB. This convergence of the IKK and MEK1/RSK pathways mediates the expression of adhesion molecules in VSMCs.
Acknowledgments
This project was supported by NIH grants RO1 HL 70762 and 1P50-DK064233 and a Scientist Development Grant from the American Heart Association. We are indebted to Drs W.E. Mitch and D.A. Konkel for helpful discussions and critical reading of the manuscript. We thank E. Tamayo for technical assistance.
References
Brown K, Gerstberger S, Carlson L, Franzoso G, Siebenlist U. Control of I kappa B-alpha proteolysis by site-specific, signal-induced phosphorylation. Science. 1995; 267: 1485eC1488.
Mercurio F, Zhu H, Murray BW, Shevchenko A, Bennett BL, Li J, Young DB, Barbosa M, Mann M, Manning A, Rao A. IKK-1 and IKK-2: cytokine-activated IkappaB kinases essential for NF-kappaB activation. Science. 1997; 278: 860eC866.
Luft FC. Angiotensin, inflammation, hypertension, and cardiovascular disease. Curr Hypertens Rep. 2001; 3: 61eC67.
Wolf G, Wenzel U, Burns KD, Harris RC, Stahl RA, Thaiss F. Angiotensin II activates nuclear transcription factor-kappaB through AT1 and AT2 receptors. Kidney Int. 2002; 61: 1986eC1995.
Wu L, Iwai M, Li Z, Shiuchi T, Min LJ, Cui TX, Li JM, Okumura M, Nahmias C, Horiuchi M. Regulation of inhibitory protein-kappaB and monocyte chemoattractant protein-1 by angiotensin II type 2 receptor-activated Src homology protein tyrosine phosphatase-1 in fetal vascular smooth muscle cells. Mol Endocrinol. 2004; 18: 666eC678.
Han Y, Runge MS, Brasier AR. Angiotensin II induces interleukin-6 transcription in vascular smooth muscle cells through pleiotropic activation of nuclear factor-kappa B transcription factors. Circ Res. 1999; 84: 695eC703.
Zhang L, Ma Y, Zhang J, Cheng J, Du J. A new cellular signaling mechanism for angiotensin II activation of NF-kappaB. An IkappaB-independent, RSK-mediated phosphorylation of p65. Arterioscler Thromb Vasc Biol. 2005; 25: 1148eC1153.
Zhong H, May MJ, Jimi E, Ghosh S. The phosphorylation status of nuclear NF-kappa B determines its association with CBP/p300 or HDAC-1. Mol Cell. 2002; 9: 625eC636.
Vermeulen L, De Wilde G, Van Damme P, Vanden Berghe W, Haegeman G. Transcriptional activation of the NF-kappaB p65 subunit by mitogen- and stress-activated protein kinase-1 (MSK1). EMBO J. 2003; 22: 1313eC1324.
Duran A, Diaz-Meco MT, Moscat J. Essential role of RelA Ser311 phosphorylation by zetaPKC in NF-kappaB transcriptional activation. EMBO J. 2003; 22: 3910eC3918.
Wang D, Westerheide SD, Hanson JL, Baldwin AS Jr. Tumor necrosis factor alpha-induced phosphorylation of RelA/p65 on Ser529 is controlled by casein kinase II. J Biol Chem. 2000; 275: 32592eC32597.
Yang F, Tang E, Guan K, Wang CY. IKK beta plays an essential role in the phosphorylation of RelA/p65 on serine 536 induced by lipopolysaccharide. J Immunol. 2003; 170: 5630eC5635.
Rodriguez-Puyol M, Griera-Merino M, Perez-Rivero G, Diez-Marques ML, Ruiz-Torres MP, Rodriguez-Puyol D. Angiotensin II induces a rapid and transient increase of reactive oxygen species. Antioxid Redox Signal. 2002; 4: 869eC875.
Gao Z, Hwang D, Bataille F, Lefevre M, York D, Quon MJ, Ye J. Serine phosphorylation of insulin receptor substrate 1 by inhibitor kappa B kinase complex. J Biol Chem. 2002; 277: 48115eC48121.
Wu RC, Qin J, Hashimoto Y, Wong J, Xu J, Tsai SY, Tsai MJ, O’Malley BW. Regulation of SRC-3 (pCIP/ACTR/AIB-1/RAC-3/TRAM-1) Coactivator activity by I kappa B kinase. Mol Cell Biol. 2002; 22: 3549eC3561.
Sakurai H, Suzuki S, Kawasaki N, Nakano H, Okazaki T, Chino A, Doi T, Saiki I. Tumor necrosis factor-alpha-induced IKK phosphorylation of NF-kappaB p65 on serine 536 is mediated through the TRAF2, TRAF5, and TAK1 signaling pathway. J Biol Chem. 2003; 278: 36916eC36923.
Du J, Delafontaine P. Inhibition of vascular smooth muscle cell growth through antisense transcription of a rat insulin-like growth factor I receptor cDNA. Circ Res. 1995; 76: 963eC972.
Zhang L, Cui R, Cheng X, Du J. Antiapoptotic effect of serum and glucocorticoid-inducible protein kinase is mediated by novel mechanism activating I(kappa)B kinase. Cancer Res. 2005; 65: 457eC464.
Iademarco MF, McQuillan JJ, Dean DC. Vascular cell adhesion molecule 1: contrasting transcriptional control mechanisms in muscle and endothelium. Proc Natl Acad Sci U S A. 1993; 90: 3943eC3947.
Chen XL, Zhang Q, Zhao R, Ding X, Tummala PE, Medford RM. Rac1 and superoxide are required for the expression of cell adhesion molecules induced by tumor necrosis factor-alpha in endothelial cells. J Pharmacol Exp Ther. 2003; 305: 573eC580.
Minami T, Aird WC. Thrombin stimulation of the vascular cell adhesion molecule-1 promoter in endothelial cells is mediated by tandem nuclear factor-kappa B and GATA motifs. J Biol Chem. 2001; 276: 47632eC47641.
Thomas WG, Brandenburger Y, Autelitano DJ, Pham T, Qian H, Hannan RD. Adenoviral-directed expression of the type 1A angiotensin receptor promotes cardiomyocyte hypertrophy via transactivation of the epidermal growth factor receptor. Circ Res. 2002; 90: 135eC142.
Delhase M, Hayakawa M, Chen Y, Karin M. Positive and negative regulation of IkappaB kinase activity through IKKbeta subunit phosphorylation. Science. 1999; 284: 309eC313.
Tang ED, Inohara N, Wang CY, Nunez G, Guan KL. Roles for homotypic interactions and transautophosphorylation in IkappaB kinase beta (IKKbeta) activation. J Biol Chem. 2003; 278: 38566eC38570.
Hirotani S, Otsu K, Nishida K, Higuchi Y, Morita T, Nakayama H, Yamaguchi O, Mano T, Matsumura Y, Ueno H, Tada M, Hori M. Involvement of nuclear factor-kappaB and apoptosis signal-regulating kinase 1 in G-protein-coupled receptor agonist-induced cardiomyocyte hypertrophy. Circulation. 2002; 105: 509eC515.
Izumiya Y, Kim S, Izumi Y, Yoshida K, Yoshiyama M, Matsuzawa A, Ichijo H, Iwao H. Apoptosis signal-regulating kinase 1 plays a pivotal role in angiotensin II-induced cardiac hypertrophy and remodeling. Circ Res. 2003; 93: 874eC883.
O’Mahony A, Lin X, Geleziunas R, Greene WC. Activation of the heterodimeric IkappaB kinase alpha (IKKalpha)-IKKbeta complex is directional: IKKalpha regulates IKKbeta under both basal and stimulated conditions. Mol Cell Biol. 2000; 20: 1170eC1178.